Insights into protein kinase a activation using cAMP analogs and amide h 2h exchange mass spectrometry

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

... that HSL gains accessible hydrophobic surface area upon PKA phosphorylation This gain in hydrophobic surface area presumably accounts for the increase in in vitro activity of HSL following PKA ... solvent-exposed hydrophobic surface area of HSL following PKA phosphorylation was examined using both bis-ANS and SYPRO Orange Because of the interaction of bot...

Ngày tải lên: 18/02/2014, 11:20

11 562 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Bhagwat SV, Biswas G, Anandatheerthavarada HK, Addya S, Pandak W & Avadhani NG (199 9) Dual targeting property of the N-terminal signal sequence of P450 1A1 Targeting of heterologous proteins to ... open N-terminal signal domain is critical for protein targeting to the ER (Fig 2D) In contrast to the targeting of CYP 1A1 requiring N-terminal truncation, w...

Ngày tải lên: 18/02/2014, 16:20

16 651 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... nucleotide exchange factor with activity towards Ras Results HEK293 cells express the guanine nucleotide exchange factor Ras-GRF1 The guanine nucleotide exchange factor Ras-GRF1 is mainly expressed in ... physiological role of the guanine nucleotide exchange activity of the truncated forms is not known as they are missing the Ca2+ ⁄ CaM-bindin...

Ngày tải lên: 19/02/2014, 18:20

13 730 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351 -SUT2 was constructed to contain SUT2 as the ... yeast/ info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACA...

Ngày tải lên: 07/03/2014, 15:20

8 485 0
Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

... Madrid, L.V., Mayo, M.W., Reuther, J.Y & Baldwin, A. S Jr (2001) Akt stimulates the transactivation potential of the RelA/ p65 subunit of NF-kappa B through utilization of the Ikappa B kinase and ... PKA activation does not affect IjB degradation nor DNA-binding activity of NF-jB PKA impairs transactivation potential of p65 In the unstimulated cells, NF-jB is seques...

Ngày tải lên: 08/03/2014, 10:20

7 296 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

... pivot about the stable AKAP-bound dimerization and docking domain, and to weakly associate with another part of the molecule, possibly the tandem cAMP binding domains of the regulatory subunit ... secondary, tertiary, and quaternary structure packing and stability In addition, we discuss the role of charges in function of RIIa D/D MATERIALS AND METHODS Sampl...

Ngày tải lên: 08/03/2014, 22:20

12 537 0
Báo cáo khoa học: Recent insights into cerebral cavernous malformations: animal models of CCM and the human phenotype pptx

Báo cáo khoa học: Recent insights into cerebral cavernous malformations: animal models of CCM and the human phenotype pptx

... function and lesion biology By exploring the function of the CCM genes in animal models this gap is being CCM animal models bridged Animal models have demonstrated the central importance of endothelial ... increase in both the intracerebral hemorrhage phenotype of rap1b and the cardiac developmental phenotype of san The zebrafish experiments demonstr...

Ngày tải lên: 15/03/2014, 10:20

8 417 0
Báo cáo khoa học: Malonyl-CoA decarboxylase (MCD) is differentially regulated in subcellular compartments by 5¢AMP-activated protein kinase (AMPK) Studies using H9c2 cells overexpressing MCD and AMPK by adenoviral gene transfer technique potx

Báo cáo khoa học: Malonyl-CoA decarboxylase (MCD) is differentially regulated in subcellular compartments by 5¢AMP-activated protein kinase (AMPK) Studies using H9c2 cells overexpressing MCD and AMPK by adenoviral gene transfer technique potx

... examine the role of AMPK in the regulation of MCD MCD activity in H9c2 cells coinfected with Ad.CA -AMPK and Ad .MCD Infection of H9c2 cells with Ad .MCD resulted in a significant increase in MCD protein ... Ad.CAAMPK cells, P ¼ 0.058; Fig 2Biv) MCD expression and activity in subcellular fractions of H9c2 cells overexpressing both MCD and AMPK...

Ngày tải lên: 16/03/2014, 16:20

10 399 0
Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx

Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx

... respectively Phosphorylation was confirmed by analysis of the recombinant emerin by electrospray ionisation mass Fig Baculovirus expressed 1–176 emerin analyzed by ESI Q-TOF mass spectrometry (A) The raw ... (ONJ) ONJ is a Lundbeck Foundation Research Professor 12 13 References Nagano A, Koga R, Ogawa M, Kurano Y, Kawada J, Okada R, Hayashi YK, Tsukahara T & Arahata K (1996...

Ngày tải lên: 17/03/2014, 17:20

14 418 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... band seen in NT2-N cells is present in brain, but not in PBL (Fig 3A, lanes and 3) To examine whether the CbD4 variants were expressed in different parts of the...

Ngày tải lên: 30/03/2014, 04:20

13 344 0
Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

... cyclooxygenase pathway PGE2 is the major prostanoid synthesized by lung fibroblasts [11] It can also act on fibroblasts in a paracrine fashion after release from the adjacent epithelial layer [12] In addition ... differential modulation of the translation rate or the rate of internalization and degradation of PAR-1 protein As we and others [15–17,26,33] h...

Ngày tải lên: 30/03/2014, 04:20

11 338 0
Báo cáo Y học: The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei docx

Báo cáo Y học: The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei docx

... consistently coprecipitated a protein kinase activity exhibiting many characteristics of the catalytic subunit of trypanosomal PKA The coprecipitated kinase is recognized by an antibody against the ... demonstrated the presence of a PKA-like kinase activity in T cruzi [29] The current study describes the identification and characterization of the regulatory...

Ngày tải lên: 31/03/2014, 23:20

10 494 0
Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps

Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps

... article as: Yen et al.: Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats ... adenylate cyclase; ADM: adrenomedullin; ADMR: adrenomedullin receptor; GC: guanylate cyclase; Gs: stimulatory GTP-binding protein; nNOS: neuro...

Ngày tải lên: 10/08/2014, 05:21

9 634 0
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

... this article as: Danan et al.: Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits ... were called late blight meta-QTLs”, and meta-QTLs of maturity, vigour and plant height were called maturity meta-QTLs” Additional material...

Ngày tải lên: 11/08/2014, 11:21

17 593 0
Insights into protein kinase a activation using cAMP analogs and amide h 2h exchange mass spectrometry

Insights into protein kinase a activation using cAMP analogs and amide h 2h exchange mass spectrometry

... Insights into Protein Kinase A Activation using cAMP Analogs and Amide H/ 2H Exchange Mass Spectrometry TANUSHREE BISHNOI A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT ... was coupled with 8-AEA -cAMP through a spacer arm A bed volume of ml of the resin was taken in a 50 ml tube The resin was reactivated by three alternative washes w...

Ngày tải lên: 16/10/2015, 15:36

0 164 0
w