role of protein kinase a and extracellular signal regulated kinases

Báo cáo y học: "Serine/threonine kinase-protein kinase B and extracellular signal-regulated kinase regulate ventilator-induced pulmonary fibrosis after bleomycin-induced acute lung injury: a prospective, controlled animal experiment" pptx

Báo cáo y học: "Serine/threonine kinase-protein kinase B and extracellular signal-regulated kinase regulate ventilator-induced pulmonary fibrosis after bleomycin-induced acute lung injury: a prospective, controlled animal experiment" pptx

... III procollagen, forward primer 5'-GGAAAGGATGGAGAGTCAGGAA-3' and reverse primer 5'-CATTGCGTCCATCAAAGCCT-3'; and GAPDH (internal control), forward primer 5'-AATGCATCCTGCACCACCAA-3' and reverse ... hightidal-volume-induced neutrophil infiltration and different MAPK pathways and Akt, as well as the role of different MAPK pathways, extracellular signal- regulated kinase (ERK) 1/2 and p38, and Akt, ... experiment DAQ is an Assistant Professor of Medicine at Harvard Medical School, an Associated Physician at Massachusetts General Hospital, and an employee of Novartis Pharmaceuticals Novartis Pharmaceuticals...

Ngày tải lên: 13/08/2014, 11:22

14 337 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... Omura T (2006) Mitochondrial P450s Chem Biol Interact 163, 86–93 Bhagwat SV, Biswas G, Anandatheerthavarada HK, Addya S, Pandak W & Avadhani NG (1999) Dual targeting property of the N-terminal signal ... conserved among mammals and yeast [24,25] As protein trafficking has been very well characterized in budding yeast and is thought to involve a similar translocation mechanism as that in mammalian cells, ... of Pennsylvania Journal compilation ª 2007 FEBS N B V Sepuri et al Boopathi E, Anandatheerthavarada HK, Bhagwat SV, Biswas G, Fang JK & Avadhani NG (2000) Accumulation of mitochondrial P450MT2,...

Ngày tải lên: 18/02/2014, 16:20

16 651 0
A novel membrane pool of protein kinase c and its role in mammalian cell signaling

A novel membrane pool of protein kinase c and its role in mammalian cell signaling

... the agents that regulate activity 1.2.2 Classification and superfamily of protein kinases The eukaryotic protein kinases make up a large superfamily of homologous proteins The kinase domains that ... subfamilies31 In humans, a total of 518 protein kinases have been identified including 478 human eukaryotic protein kinases and 40 atypical protein kinases The protein kinases constitute about ... that protein kinases and protein phosphatases are equally important in signal transduction and integration within the cells, however, this research focuses on protein kinases Protein kinases are...

Ngày tải lên: 12/09/2015, 21:10

221 308 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

... N-terminal amide and His2 Aspartic acids Asp27 and Asp30 show lower mean pKa values than their model pKa values This may be a general property of Asp residues, as it has been observed in another ... grids of 2.5, 1.25, 0.5, and 0.25 A The parameter set of charges and van der Waals radii PARSE [24], dielectric constants of 78.4 and 20.0, for solvent and protein, respectively, temperature of ... and quaternary structure packing and stability In addition, we discuss the role of charges in function of RIIa D/D MATERIALS AND METHODS Sample preparation and NMR spectroscopy Sample preparations...

Ngày tải lên: 08/03/2014, 22:20

12 537 0
Báo cáo khoa học: Role of extracellular signal regulated kinases 1 and 2 in neuronal survival docx

Báo cáo khoa học: Role of extracellular signal regulated kinases 1 and 2 in neuronal survival docx

... ultimate results of the same signaling events Finally, chronic activation of a signaling pathway may lead to an increased activity of inhibitory feedback pathways switching off downstream signaling ... cell damage by activation of death signaling pathways However, at the same time, cells may also mobilize defense mechanisms in an attempt to counteract cell death and enable damage repair Interestingly, ... survival and differentiation of cortical progenitors via distinct signaling pathways J Neurosci 23, 5149– 5160 Dash, P.K., Mach, S .A & Moore, A. N (2002) The role of extracellular signal- regulated kinase...

Ngày tải lên: 30/03/2014, 14:20

6 440 0
báo cáo khoa học: "The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma" ppt

báo cáo khoa học: "The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma" ppt

... Newton AC: Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Biochem J 2003, 370:361-371 Parker PJ, Parkinson SJ: AGC protein kinase phosphorylation and protein kinase ... significance of morphologic parameters in renal cell carcinoma Am J Surg Pathol 1982, 6:655-663 Yamada S, Yanamoto S, Kawasaki G, Rokutanda S, Yonezawa H, Kawakita A, Nemoto TK: Overexpression of ... assessed by the Fischer’s exact test Continuous data are expressed as mean ± standard deviation Statistical significance was analyzed by one-way Page of analysis of variance (ANOVA) followed by Bonferroni’s...

Ngày tải lên: 10/08/2014, 10:21

9 309 0
Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx

Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx

... protein kinase C We have measured the dynamic time profile of ERK phosphorylation after stimulation by EGF, and observed a biphasic pattern consisting of a first rapid peak and relatively low and ... MAP kinase cascade activated by surface and internalized EGF receptors Nat Biotechnol 20, 370–375 Bhalla, U.S., Ram, P.T & Iyengar, R (2002) MAP kinase phosphatase as a locus of flexibility in a ... cAMP-dependent kinase and MAP kinase through a protein tyrosine phosphatase Nat Cell Biol 1, 305–311 56 Asthagiri, A. R., Reinhart, C .A. , Horwitz, A. F & Lauffenburger, D .A (2000) The role of transient ERK2 signals...

Ngày tải lên: 19/02/2014, 16:20

9 541 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... human human Rhesus monkey mouse Lower primer (5¢- to 3¢) CGGGAACCACTATGCC ACACAAAGCCACTGAA (V) CCCTTCTTGCCATCG (I) GCCGGTTATTTCATAGACAC (II) AAGACGTTTAGGTGCAAT (III) CCCTTTGCTGTTGGAT (IV) TGCCATGAAGATCTTAGA ... human fetal brain, human adult hippocampus, cerebral cortex and amygdala was purchased from BioChain Institute (Hayward, CA, USA) as PCR Ready First strand cDNA Total RNA from human adult brain (1.1...

Ngày tải lên: 30/03/2014, 04:20

13 344 0
Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc

Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc

... other kinases MAPK cascades are composed of many kinds of kinases and are intricately regulated However, downstream of these pathways can simply be classified into three major groups mediated by ... Miyazaki, Y., Osaki, M., Shindo, H & Yamashita, S (2000) Activation of specific MEKERK cascade is necessary for TGF beta signaling and crosstalk with PKA and PKC pathways in cultured rat articular ... mitogen-activated protein kinase pathway Proc Natl Acad Sci USA 97, 1113–1118 Yonekura, A. , Osaki, M., Hirota, Y., Tsukazaki, T., Miyazaki, Y., Matsumoto, T., Ohtsuru, A. , Namba, H., Shindo, H & Yamashita,...

Ngày tải lên: 24/03/2014, 04:21

8 377 0
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

... a. a amino acid AD Alzheimer’s disease APP amyloid precursor protein ATP adenosine triphosphate c-abl c-Abelson CAK Cdk activating kinase CaMKII Ca2+/calmodulin-dependent protein kinase II cAMP ... dual specificity (Ser/Thr and Tyr) class of kinases, depending on the residue being targeted for phosphorylation All known protein kinases of this class share a related catalytic domain and are ... designated casein kinase (CK1) and casein kinase (CK2) according to the elution profile obtained by diethylamino-ethylcellulose (DEAE-cellulose) chromatography (Hathaway and Traugh, 1979) Protein kinase...

Ngày tải lên: 16/09/2015, 17:10

182 480 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢ Phospho-ERK1 ... overexpression of Epac and mimicked by a cAMP analogue stimulating both PKA and Epac, but not by an Epac-specific cAMP analogue [25] The differences in H89 sensitivity and possible signalling pathways involved ... kDa and  60 kDa isoforms of Ras-GRF1 (Fig 2A, left panel) and of recombinant HA-Ras-GRF1 (Fig 2B, upper panel) Phosphorylation of ERK1 ⁄ in the same samples was fully induced after of treatment...

Ngày tải lên: 19/02/2014, 18:20

13 730 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... Hagiwara, Y., Hagiwara, H., Ueyama, H & Goldstein, A. L (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulates release of prolactin and growth hormone from rat anterior ... not of the antioxidants BHA and AsA These results suggested that active oxygens and free radicals did not participate in the TS effect, and that the inhibitory effect of a- T was mediated by a nonantioxidative ... antibody or rabbit anti-PKC polyclonal antibody at : 1000 dilution and anti-(rabbit IgG) Ig horseradish peroxidase conjugated antibody at : 5000 dilution as a primary antibody and a secondary antibody,...

Ngày tải lên: 22/02/2014, 04:20

6 494 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot

Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot

... Se, 5¢-GGGAACAGAGCGGAUAGGATT-3¢; scrambled c-Jun siRNA2 Se, 5¢-GAAAGAUGGCAGAAUAGAATT-3¢; and scrambled c-Jun siRNA3 Se, 5¢-GAAAGCCUUAAGAA UUGUATT-3¢) The transfection of rat primary hepatocytes ... compilation ª 2011 FEBS Y Ishihara et al Clara, CA, USA) (primers: AP-1 Se, 5¢-CCGTCAGCGGT GACTTGGATTCACAGAGAC-3¢; FOXO Se, 5¢-CAAGT CACTAGGGTACCCACGCCGGGGTGG-3¢; Myb1 Se, 5¢-GACCAAGATGGTCCATCGGTGGGACGACAG-3¢; ... 5¢-CCAGATCCCCACTTTTCATC-3¢; and Rv, 5¢-AAGAG AAATACCCACTGGAGGA-3¢ The sequence of the TaqMan fluorogenic probe was 5¢-TGCTGTCC-3¢ (Universal ProbeLibrary, Roche Diagnostics, Basel, Switzerland)...

Ngày tải lên: 06/03/2014, 00:21

9 556 0
Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: fine-tuning of autophagy in Caenorhabditis elegans homeostasis doc

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: fine-tuning of autophagy in Caenorhabditis elegans homeostasis doc

... extracellular signal- regulated kinase, which phosphorylates and activates Ga interacting proteins and stimulates autophagy and (f) the eukaryotic initiation factor 2a, which regulates starvation- ... FEBS C Kang and L Avery In C elegans, we showed that starvation activates muscarinic acetylcholine signaling, which in turn activates extracellular signal- regulated kinase and induces autophagy through ... (Fig 2) Autophagy signaling pathway During the past decade, several signaling pathways involved in the regulation of autophagy have been discovered These include: (a) mammalian target of rapamycin...

Ngày tải lên: 29/03/2014, 08:20

8 376 0
Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot

... were as follows: PAR-1, forward 5¢-CCTGCTTCAGTCTGTGC-3¢, reverse 5¢-CCAGGTGCAGCATGTACA-3¢; COL 1A1 , forward 5¢-CAAGACGAAGACATCCCACCA-3¢, reverse 5¢-CAGATCACGTCATCGCACAACA-3¢; AP-2, forward 5¢-ATGCCGTCTCCGCCATCCCTAT-3¢, ... 40 000) Quantification of the band densities was carried out using a GS-800 calibrated densitometer and quantity one software (Bio-Rad) Statistical analysis Statistical evaluation was carried out ... NECA (A) PAR-1 mRNA levels after treatment with PGE2 and cAMP-elevating agents for h Total RNA was isolated and used for real-time PCR Modulation of mRNA expression was calculated using the GAPDH...

Ngày tải lên: 30/03/2014, 04:20

11 338 0
Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

... displayed mean values (and standard deviations) from at least independent determinations localized and transient changes of chromatin organization that would otherwise inhibit repair [34-36] Notably, ... doi:10.1186/1748-717X-6-15 Cite this article as: Zwicker et al.: A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells Radiation Oncology ... Pinna LA, Caldecott KW: The protein kinase CK2 facilitates repair of chromosomal DNA single-strand breaks Cell 2004, 117:17-28 14 Melander F, Bekker-Jensen S, Falck J, Bartek J, Mailand N, Lukas...

Ngày tải lên: 09/08/2014, 09:20

13 289 0
Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps

Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps

... At the same time, as the origin of a life -and- death signal [5] that reflects failure of the central cardiovascular regulatory machinery during brain stem death [6-8] and a brain stem site via ... prolife program As a member of the mitogen-activated protein kinases (MAPKs), ERK1/2 pathway is activated specifically by MAPK kinase 1/2 (MEK1/2), and is an important signal for cell survival [14-19] ... 78:631-639 Nakata S, Tsutsui M, Shimokawa H, Tamura M, Tasaki H, Morishita T, Suda O, Ueno S, Toyohira Y, Nakashima Y, Yanagihara N: Vascular neuronal NO synthase is selectively upregulated by platelet-derived...

Ngày tải lên: 10/08/2014, 05:21

9 201 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

... mix, and mixed with SYPRO Orange, and spectra were recorded at an excitation wavelength of 492 nm Spectra of reaction mixes lacking HSL or both HSL and kinase were subtracted from the spectra of ... assay was reliable only within a limited range of probe concentrations), dialysis after phosphorylation was not necessary, probably because of a lower degree of interaction of ATP with SYPRO Orange ... of TO activity by bis-ANS was decreased upon phosphorylation A possible explanation for this apparent discrepancy could be that PKA phosphorylation induces a conformational change that increases...

Ngày tải lên: 18/02/2014, 11:20

11 562 0
Tài liệu Báo cáo khoa học: Rac upregulates tissue inhibitor of metalloproteinase-1 expression by redox-dependent activation of extracellular signal-regulated kinase signaling pptx

Tài liệu Báo cáo khoa học: Rac upregulates tissue inhibitor of metalloproteinase-1 expression by redox-dependent activation of extracellular signal-regulated kinase signaling pptx

... (ROS) formation and the activities of extracellular signal- related kinase (ERK) 1,2, p38 mitogen-activated protein kinase (p38 MAPK), Rho, and Cdc42 in stably transfected renal cell carconoma (RCC) ... roles of (a) AP-1 in regulating the transcription of numerous genes, and (b) of TIMP-1 as an inhibitor of tumor invasion and metastasis as well as a regulator of cell proliferation and apoptosis, ... inhibitors of the direct upstream kinases of ERK1,2 ) mitogen-activated protein kinase kinase (MEK1,2) (PD098059 and U0126) ) as well as catalase attenuated C1199-Tiam1-induced upregulation of TIMP-1...

Ngày tải lên: 19/02/2014, 05:20

16 485 0
Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx

Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx

... crystal structure data 266 ´ D Hernandez-Romero et al The only data so far available are for sweet potato (Ipomoea batata) catechol oxidase [26] The catalytic copper center is accommodated in a ... Omura S, Ikeda H, Ishikawa J, Hanamoto A, Takahashi C, Shinose M, Takahashi Y, Horikawa H, Nakazawa H, Osonoe T, et al (2001) Genome sequence of an industrial microorganism Streptomyces avermitilis: ... A novel tyrosinase from Rastonia solanacearum ´ D Hernandez-Romero et al A B C particular catechol to o-dopaquinone is also called dopa oxidase (DO) activity On the other hand, laccases...

Ngày tải lên: 19/02/2014, 07:20

14 849 0
w