Large area plasmonic structure fabrication and tuning of surface plasmon resonance

... 2006 Acquisition and analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, ... distance for (a) mirror magnetic field, and (b) flat magnetic field the magnetic field can cause diffusion of the plasma particles to the wall of the plasma ch...

Ngày tải lên: 22/12/2013, 08:58

... each of the other 19 amino-acid residues showed that Y8 1A, Y8 1G and Y8 1S are capable of making hexaprenyl pyrophosphate (C30) [59] The final products of Y8 1C, Y8 1H, Y8 1I, Y8 1L, Y8 1N, Y8 1T and Y8 1V ... linear polyprenyl pyrophosphates, and the reaction mechanism and structures of protein prenyltransferases and isoprenyl diphosphate cyclases As illustrat...

Ngày tải lên: 08/03/2014, 22:20

... things (herpes and HIV in humans, for example) Viruses are found everywhere Viruses consist of a core of nucleic acid, either DNA or RNA, and a protective coat of protein molecules and sometimes ... Viruses The Boundary of Life At the boundary of life, between the macromolecules (which are not alive) and the prokaryotic cells (which are), lie the viruses and bacter...

Ngày tải lên: 15/03/2014, 13:08

... Structure, regulation and evolution of Nox H Sumimoto Introduction Reactive oxygen species (ROS) are conventionally regarded as inevitable deleterious byproducts of aerobic metabolism ... enzymes, and not EF-hand-containing oxidases such as Nox5 and Duox, although these two families are found in a variety of species of protostomes and deuterostomes (Fig 3) Thus...

Ngày tải lên: 16/03/2014, 06:20

... and encapsulated using glass rings and a biocompatible epoxy glue Please cite this article in press as: X.T Vu, et al., Fabrication and application of silicon nanowire transistor arrays for biomolecular ... et al., Fabrication and application of silicon nanowire transistor arrays for biomolecular detection, Sens Actuators B: Chem (2009), doi:10.101...

Ngày tải lên: 16/03/2014, 15:24

... 3 1 1 1 1 )4 71, +467 )4 71 )4 71, )1 16 )3 96 )3 48 )3 48 )3 18, +109, +201 )2 67 )2 19, )1 38, +206 )1 53 )5 3 )5 2 )5 2 +222 +260 +423 +465 +466 a Numbers refer to the position of the 5¢-end of the conserved ... throughout the brain tissue in R6/1 compared to R6/2 mice [29,30] The differences between the two transgenic line...

Ngày tải lên: 16/03/2014, 18:20

... on working electrodes made of highly ordered anodic titanium oxide nanotube arrays of varied tube length directly formed on Ti foil The lengths of these ATO NT were controlled from to 41 µm while ... Because of the robust structure of the NT arrays and the loose structure of the surface debris, the unwanted deposits on the ATO surface Anodic TiO2 Nanotube Arra...

Ngày tải lên: 19/03/2014, 16:48

... techniques, as the frequencies and band intensities of vibrational transitions represent a unique fingerprint of the specific conformation of a molecule SERR and SEIRA spectroscopy of cytochrome c [10] Both ... excitation of surface plasmons of Au is restricted to the region above  550 nm [10] This limitation has severe consequences for SERR spectroscopy: since the elect...

Ngày tải lên: 22/03/2014, 16:20

... the top of the stack to a guanine on the bottom, resulting in a double-chain reversal loop Further details and images are available in Phan [11] Structure, location and interactions of G-quadruplexes ... Journal compilation ª 2010 FEBS 3453 Structure, location and interactions of G-quadruplexes J L Huppert Pluckthun and co-workers [21] demonstrated that ¨ G-quad...

Ngày tải lên: 23/03/2014, 03:20

... mut STAT5 AGATTTCTAGGAATTCAATCC AGATTTAGTTTAATTCAATCC STAT6 CCGCTGTTGCTCAATCGACTTCCCAA GAACA CCGCTGTTGCTCAATCGACTAGCCAA GAACA GCCGTGTAGTTTCTTGGAAATTTCTGG GCCGTGTAGTTTAGATTAAATTTCTGG mut STAT6 Int16 ... CATGTTATGCATATTCCTGTAAGTG CATGTTATGCATATTGGAGTAAGTG STAT3 mut STAT3 GATCCTTCTGGGAATTCCTAGATC GATCCTTCTGGGCCGTCCTAGATC STAT4 mut STAT4 GAGCCTGATTTCCCCGAAATGATGAGC GAGCCTGATTTCTTTGAAATGATGAGC...

Ngày tải lên: 31/03/2014, 07:20

... Fabrication and Design of Resonant Microdevices Micro & Nano Technologies Series Editor: Jeremy Ramsden Professor of Nanotechnology Microsystems and Nanotechnology Centre, Department of Materials ... with quality factors of and 25 and identical resonant frequencies of ω0 = 1000 rad/sec Figure 1.4 The step response of a resonator with a Q of 25 and resonant...

Ngày tải lên: 04/06/2014, 15:18

... processing of large-scale graphene Nat Nanotech 2009, 4:25-29 doi:10.1186/1556-276X-7-53 Cite this article as: Kim et al.: Fabrication and characterization of carbon-based counter electrodes prepared by ... graphene, SWNTs, and graphene-SWNT composites could perform sufficiently well as counter electrodes for DSSCs Figure Nyquist plot of DSSCs Nyquist plot of D...

Ngày tải lên: 20/06/2014, 23:20

... Y: Surface-enhanced Raman scattering of biological molecules on metal colloid II: effects of aggregation of gold colloid and comparison of effects of pH of glycine solutions between gold and silver ... and evolution of multilayer silver nanofilms for surface-enhanced Raman scattering sensing of arsenate Nanoscale Research Letters 2011 6:263 Subm...

Ngày tải lên: 21/06/2014, 04:20

... LARGE AREA PLASMONIC NANOSTRUCTURES DESIGN, FABRICATION AND CHARACTERIZATION BY LASER XU LE (M Eng, Xi'an Jiaotong University) A THESIS ... thesis aims to design and fabricate desirable nanostructures over a large area by low-cost and flexible nanofabrication methods to accomplish and improve sensing sensitivities of plasmonic bio/chemical ... the design a...

Ngày tải lên: 09/09/2015, 11:17

... Large Area Plasmonic Structure Fabrication and Tuning of Surface Plasmon Resonance BY LIU CAIHONG (M Sc., Xiamen University, P R China) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... investigation of the tuning of the surface plasmon resonance 1.2 Fabrication techniques of plasmonic nanostructures To generate strong surface plasmo...

Ngày tải lên: 16/10/2015, 11:57