Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferfish (Tetraodon fluviatilis) ppt

Genomic structure, expression and characterization of a STAT5 homologue from pufferfish ( Tetraodon fluviatilis ) Shu-Chiun Sung 1,2 , Ting-Jia Fan 1 , Chih-Ming Chou 3 , Jiann-Horng Leu 1 , Ya-Li Hsu 4 , Shui-Tsung Chen 1 , Yueh-Chun Hsieh 1 and Chang-Jen Huang 1 1 Graduate Institute of Life Science, National Defense Medical Center, Taipei, Taiwan; 2 Institute of Biological Chemistry, and 4 Zoology, Academia Sinica, Taipei, Taiwan; 3 Department of Biochemistry, Taipei Medical University, Taipei, Taiwan The STAT5 (signal transducer and activator of transcription 5) gene was isolated and characterized from a round-spotted pufferfish genomic library. This gene is composed of 19 exons spanning 11 kb. The full-length cDNA of Tetraodon fluviatilis STAT5 (TfSTAT5) contains 2461 bp and encodes a protein of 785 amino acid residues. From the amino acid sequence comparison, TfSTAT5 is most similar to mouse STAT5a and STAT5b with an overall identity of 76% and 78%, respectively, and has < 35% identity with other mammalian STATs. The exon/intron junctions of the TfSTAT5 gene were almost identical to those of mouse STAT5a and STAT5b genes, indicating that these genes are highly conserved at the levels of amino acid sequence and genomic structure. To understand better the biochemical properties of TfSTAT5, a chimeric STAT5 was generated by fusion of the kinase-catalytic domain of carp Janus kinase 1 (JAK1) to the C-terminal end of TfSTAT5. The fusion protein was expressed and tyrosine-phosphorylated by its kinase domain. The fusion protein exhibits specific DNA- binding and transactivation potential toward an artificial fish promoter as well as authentic mammalian promoters such as the b-casein promoter and cytokine inducible SH2 containing protein (CIS) promoter when expressed in both fish and mammalian cells. However, TfSTAT5 could not induce the transcription of b-casein promoter via rat pro- lactin and Nb2 prolactin receptor. To our knowledge, this is the first report describing detailed biochemical characteri- zation of a STAT protein from fish. Keywords: DNA binding; pufferfish; signal transduction; STAT5; transactivation. Signal transducers and activators of transcription (STATs) are a family of latent cytoplasmic transcription factors that are activated in response to various extracellular polypep- tide ligands such as cytokines, growth factors and hormones [1–3]. Extensive studies in mammalian systems have estab- lished a paradigm for the activation mechanism of STAT molecules. Mammalian STATs can be activated by either Janus kinase (JAK)-dependent or JAK-independent path- ways. In the JAK–STAT pathway, binding of cognate ligand to the receptor triggers a series of sequential events including the association of the receptor with JAKs, tyrosine phosphorylation of the receptor by activated JAKs, and generation of the docking site for SH2-containing STAT proteins. The recruitment of STATs to the receptor leads to their tyrosine phosphorylation by the JAK kinases (JAK- dependent). STATs can also be activated by receptor tyrosine kinases, such as insulin receptor [4], epidermal growth factor receptor [5], and mutant fibroblast growth factor receptor [6], as well as by v-Src [7] and v-Abl [8]. The phosphorylated STATs form homo- or hetero-dimers and then translocate to the nucleus where they bind to specific DNA sequences and transactivate the downstream target gene. The activation of STAT is an evolutionally conserved mechanism by which signals can be transduced from membrane to the nucleus rapidly. In mammals, there are seven distinct STAT proteins [9,10], while only one related molecule has been found in Drosophila [11,12] and in the malaria vector Anopheles gambiae [13]. Among mammalian STATs, STAT1 is critical for interferon function as well as innate immunity [14,15], while STAT3 is required for interleukin (IL)-6 signalling in haematopoietic cells as well as antiapoptosis [16–18]. In addition, STAT5a and STAT5b have been shown to play important roles in growth, lactation and haematopoiesis [19–21]. In contrast with the broad range of biological effects derived from STAT1, STAT3, and STAT5, STATs 2, 4, and 6 have relatively restricted functions, centred on immune response regula- tion. STAT2 is activated only by a/b-interferon, STAT4 by IL-12andSTAT6byIL-4andIL-13[10,22,23]. STAT5a was originally identified as a mammary gland factor that can be activated by prolactin treatment and bind Correspondence to C J. Huang, Institute of Biological Chemistry, Academia Sinica, 128, Sec 2, Academia Road., Taipei, Taiwan 115. Fax: + 886 2 2788 9759, Tel.: + 886 2 2785 5696, E-mail: cjibc@gate.sinica.edu.tw Abbreviations: STAT, signal transducer and activator of transcription; JAK, Janus kinase; CIS, cytokine-inducible SH2-containing protein; HA, haemagglutinin; EMSA, electrophoretic mobility shift assay; IL, interleukin; CAT, chloramphenicol acetyltransferase; Luc, luciferase; PRL, prolactin; ST, STAT. Note: the nucleotide sequences reported in this paper have been submitted to GenBank and assigned accession numbers AF307108 and AF394166. (Received 7 April 2002, revised 20 September 2002, accepted 20 November 2002) Eur. J. Biochem. 270, 239–252 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03380.x to the promoter of the b-casein gene to regulate milk production [24]. STAT5b is closely related to STAT5a: the proteins not only have  95% amino acid identity but are also functionally redundant in some ways [25]. Moreover, STAT5 is activated by a variety of cytokines such as IL-2, IL-3, IL-5, IL-7, IL-15, granulocyte/macrophage colony- stimulating factor, erythropoietin, growth hormone, and thrombopoietin [26]. Many cytokines activating STAT5 transcriptional activity play important roles in the estab- lishment of myeloid and lymphoid lineages. To ascertain the functional roles of the STAT5 proteins, knockout mice with deletion of STAT5a and/or STAT5b [27–30] were gener- ated. The most evident phenotypes of gene knockout mice are with prolactin and growth hormone function and T-cell proliferation. In contrast, haematopoietic lineages were only slightly affected. Studies of the JAK–STAT pathway have been mostly in mammals with only few being performed in lower vertebrates. Recently, two STAT homologues, STAT1 andSTAT3,wereisolatedfromzebrafish(Danio rerio) [31]. We have previously identified four distinct genes encoding JAK1, JAK2, JAK3 and Tyk2 from the pufferfish (Tetraodon fluviatilis) [32,33]. In this study, we report the isolation and characterization of the STAT5 gene from T. fluviatilis (TfSTAT5), the third member of the STAT family from fish, to establish the evolutionary relationship of STAT5 between mammals and teleosts. T. fluviatilis posseses an extremely compact genome and can be maintained in aquaria. Compared with Fugu [34], T. fluviatilis is easily obtained making it an alternative puffer fish model for comparative genome study [35]. A complete JAK–STAT pathway has not been established in fish. STAT5 is the logical choice of a STAT gene to complete the JAK–STAT pathway, because prolactin and the prolactin receptor have both been cloned in fish [36,37]. Therefore, in this work, we also constructed a chimeric T. fluviatilis STAT5 to characterize DNA-bind- ing specificity and transactivation property of TfSTAT5. Moreover, STAT5 appears to be a good target gene, because in mammals it has been shown to regulate diverse aspects of growth and health [26]. As T. fluviatilis is a commercial aquarium species, any information about its growth or health could be valuable. Materials and methods Isolation of the STAT5 gene from a T. fluviatilis genomic library Genomic DNA was prepared from the liver of the round- spotted pufferfish (T. fluviatilis) with DNAzol reagent (Life Technologies). Using lambda FIXII as a cloning vector (Stratagene), the genomic library was constructed and amplified as reported previously [32]. Two degenerate prim- ers, ST5F (5¢-ACNTT(T/C)TGGCA(A/G)TGGTT (T/C) GA-3¢) and ST5R (5¢-AANCGNA(G/A)NA(G/A) (A/G) AANGTNCC-3¢) were generated based on the sequence of two conserved regions, TFWQWFD and GTFLLRF in most mammalian STAT proteins. With these primers and pufferfish genomic DNA as template, PCR was performed to isolate all possible STAT5 homologues from pufferfish genomic DNA. One DNA fragment of 322 bp containing partial genomic sequences of the pufferfish STAT5 (data not shown) was used as a probe to screen the genomic library mentioned above. The probe was labelled using a digeoxygenin DNA Labelling Kit (Boehringer Mannheim). Hybridization, washing, and the following chemilumines- cence detection were performed according to manufac- turer’s manual. From 1 · 10 7 plaques, three positive phage clones were isolated and the genomic DNA fragments were subcloned. To investigate whether there is another STAT5 gene in the T. fluviattilis genome, degenerate primers were designed from two stretches of cDNA sequences, 677 RPKDEVF and 698 YVKPQIKQ (see Fig. 2), in which two different genomic fragments were obtained for STAT5a and STAT5b genes, respectively, in mouse (Mus musculus) genome. PCR reaction was performed at low stringency (annealing at 42 °C) with T. fluviattilis genomic DNA as template. The PCR products were cloned into pGEM-T easy vector and sequenced. Subcloning, DNA sequence analysis and phylogenetic analysis Parental clones and restriction fragment subclones were sequenced using PRISM Ready Reaction Dye Deoxy Termination Cycle sequencing Kit (Applied Biosystems) on an Applied Biosystems 310 automated DNA sequencer. Sequence assembly and alignment were per- formed using the Genetics Computer Group software program. The exon/intron boundaries were determined by alignment of the encoded protein sequences with those of mammalian STAT2 [38], STAT3 [39], and STAT5 [40] genes. Phylogenetic analysis, based on the sequences of the DNA-binding domain, linker region and SH2 domain, were performed using CLUSTRAL X program [41,42]. RACE The 5¢ and the 3¢ end of TfSTAT5 mRNA were obtained by the RACE technique using the Marathon cDNA amplification kit (Clontech) according to the supplier’s instructions. The 5¢ RACE was performed with a 27-mer sense primer (AP1) specific for the adaptor and a STAT5-specific primer ST5R11 (5¢-CTGGTATTTCTGGGACATGGTCTCC-3¢) whereas the second-round PCR was carried out with a nested 23-mer sense primer (AP2) and a nested gene-specific antisense primer ST5R12 (5¢-GACGAGCCTCTGCTC GGTGTAAAGG-3¢). Similarly, 3¢ RACE was performed with two rounds of PCR, first with AP1 primer and ST5F5 (5¢-AGGCTCAGGACATGCTGATGTCC-3¢)andthen with AP2 primer and ST5F6 (5¢-TTCAGTGACTCTG AGATCGGAGG-3¢). According to the sequences of the clones obtained from 5¢ and 3¢ RACE, primers ST5F17 (5¢-ACTCGAGGTGTTGAAGATGGCAGTGTGG-3¢) containing a XhoI site and ST5R17 (5¢-CCTCTAGAGGT TAAAGGTCAGGACTGCTGG-3¢) containing a XbaI site were synthesized and used to amplify full-length TfSTAT5 cDNA using first-strand cDNA prepared from pufferfish gill tissues as template. The PCR products were cloned into pGEM-T vector (Promega) and sequenced. 240 S C. Sung et al. (Eur. J. Biochem. 270) Ó FEBS 2003 RNA isolation and RT/PCR Total RNA was isolated from gill, heart, intestine, liver, kidney, and testis of T. fluviatilis using the RNAzol reagent (Tel.Test, Inc.) following the manufacturer’s instructions. First-strand cDNA from different tissue was amplified from 2–5 lg total RNA using 10 pmole oliogT primer in a 25 lL reaction containing 30 U RNasin (Promega), 1 m M dNTP, 10 m M dithiothreitol, and 300 U Superscript II (Life Technologies). Incubation was performed at 42 °Cfor 1h,and2lL of the resulting reaction containing the single- stranded cDNA template were used for subsequent PCR amplification. PCR was performed in a 50-lLreaction mixture containing 200 ng b-actin primers (ActF, 5¢-CCT CCGGTCGTACCACTGGTAT-3¢ and ActR, 5¢-CAAC GGAAGGTCTCATTGCCGATCGTG-3¢)orTfSTAT5 primers (ST5F34, 5¢-GACAGTGGATGGCTATGTGAA ACCA-3¢ and STR15, 5¢-CCGCGCAAATCTAACTACG ACAGTCC-3¢, corresponding to sequences in exon 17 and the 3¢ untranslated region respectively), 1.5 m M MgCl 2 , 0.2 m M dNTP and 0.5 U ExTaq (Takara Shuzo Co.). The conditions for amplification were 96 °C for 2 min; 35 cycles of 96 °Cfor1min,50°Cfor30s,and72°C for 30 s; and final extension at 72 °C for 5 min. A negative control was performed in the absence of RNA. The products were resolved on a 1.5% agarose gel. Plasmid construction The expression vector, pTf-STAT5-HA, was constructed by inserting the full-length TfSTAT5 cDNA between the XhoIandXbaI sites of pHA-YUN, which is derived from pcDNA3 and has a haemagglutinin (HA) tag located between the KpnI site and multiple cloning sites. The pHA-YUN plasmid was kindly provided by H. J. Kung (University of California at Davis Cancer Center, Sacra- mento, CA, USA). The JH1 domain of carp JAK1 kinase [43] was generated by PCR with primers containing BamH1 and XhoI restriction sites on both ends, and cloned into the corresponding sites in pHA-YUN to generate pHA-JH1. The full-length TfSTAT5 cDNA was reamplified by PCR with primers containing SmaIand Kpn I restriction sites on both ends, and cloned into the HindIII filled-in and KpnI sites in pHA-JH1 to generate pTf-STAT5-HA-JH1. The MmSTAT5 cDNA cloned into expression vector pECE was a kind gift from H. J. Kung [44]. The cDNA of MmSTAT5 was recloned into pcDNA3 with XbaIandEcoRI. The rat Nb2 PRL-R cDNA,kindlyprovidedbyL.Y.Yu-Lee[45],was released with EcoRI from pECE vector and inserted into pcDNA3 expression vector. The reporter plasmids pb-casein-CAT containing rat b-casein gene promoter ()344 to )1) linked to the chloramphenicol acetyltransferase (CAT) gene and pCIS- luc containing mouse cytokine inducible SH2 containing protein (CIS) gene promoter ()646 to )1) linked to the fire fly luciferase (Luc) reporter gene were kindly provided by W. Doppler (Institut fur Medizinische Chemie und Bioche- mie, Innsbruck, Austria) and A. Yoshimura (Institute of Life Science, Kurume University, Kurume, Japan), respect- ively. The other reporter construct p(ST5) 2 -TK-CAT was generated by cloning two copies of the ST5-binding motif into the HindIII site of pTK-CAT, which carries a minimal thymidine kinase (TK)2 gene promoter ()364 to +122) isolated from round-spotted pufferfish [33]. The resulting clone was confirmed by DNA sequencing. In vitro transcription and translation The TNT coupled transcription/translation system pur- chased from Promega was used to analyse the in vitro synthesized TfSTAT5-HA and TfSTAT5-HA-JH1 accord- ing to the manufacturer’s instructions. Briefly, 0.2–2 lg plasmid DNA is added to the master mixture and incubated for 90 min at 30 °C. The synthesized proteins are then analysed by SDS/PAGE and visualized by autoradio- graphy. For subsequent bandshift analysis and Western blotting, [ 35 S]methionine was replaced by cold methionine (final concentration 1 m M ). Cell cultures Monkey kidney fibroblast COS-1 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, penicillin G (50 UÆmL )1 ), strepto- mycin (50 lgÆmL )1 ), and L -glutamine (2 m M ) in a humidified atmosphere of 5% CO 2 at 37 °C. Carp fin epitheloid CF cells [46] were grown in Leibovitz’s L-15 medium supplemented with 10% foetal bovine serum, penicillin G (50 UÆmL )1 ), streptomycin (50 lgÆmL )1 ), and independent of CO 2 at 28 °C. Preparation of whole cell lysates and nuclear extracts All of the plasmids used for transfections were purified by Qiagen plasmid purification kit (Qiagen Inc., Hilden, Germany). Approximately 50% confluent cells were tran- siently transfected for 5 h at 37 °C for COS-1 cells and 28 °C for CF cells, respectively, with 4 lg pTf-STAT5-HA, pTf-STAT5-HA-JH1, or pHA-YUN DNA per 100 mm dish using LIPOFECTAMIN/PLUS kit (Life Technol- ogies) according to the manufacturer’s instructions. Whole cell lysates were prepared at 48 h after transfection. In general, cells were washed twice with NaCl/P i and lysed in the lysis buffer (50 m M Tris/HCl pH 7.5, 150 m M NaCl, 1% Triton X-100, 1 m M EDTA) containing 0.2 m M Na 2 VO 4 ,and2m M phenylmethylsulfonyl fluoride [47]. Extracts were centrifuged at 4 °Cfor10minat13000g and the resulting supernatants were used for subsequent immunoprecipitations. Nuclear extracts were prepared according to the procedures described previously [48]. Briefly, cells were washed twice with NaCl/P i and solubilized with buffer A (20 m M Hepes, 1 m M KCl, 1 m M EDTA, 1m M dithiothreitol, 1 m M phenylmethanesulfonyl fluoride, 0.1 m M Na 2 VO 4 , 0.2% NP-40, 10% glycerol, 1 lgÆmL )1 for aprotinin, pepstatin, and leupeptin, pH 7.9) on ice for 30 min. Cell lysates were centrifuged at 4 °Cfor2minat 13 000 g andthepelletswereextractedwithbufferB (20 m M Hepes, 350 m M NaCl, 10 m M KCl, 1 m M EDTA, 1m M DTT, 1 m M phenylmethanesulfonyl fluoride, 0.1 m M Na 2 VO 4 , 0.2% NP-40, 10% glycerol, 1 lgÆmL )1 for apro- tinin, pepstatin, and leupepetin, pH 7.9). The extracts were centrifuged at 4 °C for 5 min at 13 000 g, and supernatants were quickly frozen and stored at )70 °C for subsequent use of electrophoretic mobility shift assay (EMSA). Ó FEBS 2003 Expression and characterization of pufferfish STAT5 (Eur. J. Biochem. 270) 241 Antibodies, immunoprecipitation and Western blotting Monoclonal antibodies against HA tag and phospho- tyrosine (PY-99) were from Santa Cruz Biotechnology. Polyclonal antisera specifically recognizing TfSTAT5 was generated from rabbit using a His-tagged TfSTAT5 fusion protein as antigen. The TfSTAT5 fusion protein was generated by amplification of the DNA fragment encoding the C-terminal end (amino acid residues 546–728) of TfSTAT5 by PCR followed by cloning of the PCR product into the His-Tag expression vector pQE30 (Qiagen). The His-tagged TfSTAT5 protein was expressed in E. coli and purified using Ni–NTA agarose column (Qiagen) under denaturing condition (1.5% sarcosine in NaCl/P i ) as described previously [43]. The purified protein was used to immunize New Zealand White rabbits by the intrasplenic immunization method [49]. The polyclonal antibodies were harvested according to the previously described method. For immunoprecipitation, anti- TfSTAT5 antibody (2 lg) was added to whole cell lysates and incubated overnight at 4 °C. The immune complexes were precipitated by a further incubation with protein A/ G-Sepharose (Santa Cruz Biotechnology), the immuno- precipitates were then washed twice with lysis buffer and eluted by boiling for 5 min in sample buffer. The immunoprecipitates or in vitro transcription/translation products were separated by SDS/PAGE (10% polyacryl- amide), then transferred to a nitrocellulose membrane and blocked with 4% skim milk in NaCl/P i . The membane was then incubated with monoclonal antibodies PY-99 or anti-HA monoclonal antibodies (Santa Cruz Biotechno- logy), and visualized by the enhanced chemiluminescent detection system (NEN Life Science Products) according to the manufacturer’s instructions. EMSA EMSA was as described previously [50]. Briefly, reactions were performed by the addition of nuclear extracts or products of in vitro transcription and translation in the presence of 32 P-labelled double-stranded oligonucleotides probes (10 000 c.p.m.Ælg )1 ) to the binding buffer [10 m M Tris/HCl pH 7.5, 50 m M NaCl, 1 m M EDTA, 1 m M dithiothreitol, 5% glycerol, 2 lg poly (dI/dC)]. Excess of unlabelled or mutant oligonucleotides were added as competitors as indicated. After incubation at room tem- perature for 30 min, the reaction mixture was loaded on a 5% polyacrylamide gel in 0.5 · Tris/borate/EDTA and run at 200 V for 2 h at room temperature. The oligonuclotides probes used in this study were commercially available, corresponding to the DNA-binding sites for mammalian STATs (Santa Cruz). The sequences of the upper strand of the normal and the corresponding mutant oligonucleotides are listed in Table 3. The probes were prepared by annealing the upper and lower strands of oligonucleotides, one of which was end-labelled with [c- 32 P]ATP by using T4 polynucleotide kinase (Boehringer Mannheim). Transactivation assay For transactivation assay, transfections were performed in six-well plates. One lg reporter plasmids pb-casein-CAT, pCIS-luc or p(ST5) 2 -TK-CAT, was cotransfected with 100 ng of expression plasmid pTf-STAT5-HA or pTf- STAT5-HA-JH1 using LIPOFECTAMIN/PLUS kit (Life Technologies). The pSV-b-galactosidase vector (Promega) carrying the SV40 promoter linked to the b-galactosidase gene and a Renilla luciferase construct containing the TK promoter linked to the Renilla luciferase were used to normalize transfection efficiency in CAT assay and luci- ferase assay, respectively. For CAT assay, cells were harvested at 48 h after transfection, CAT and b-galactosi- dase activities from the cell extracts were measured accord- ing to the published procedures [51]. The acetylated products of the CAT assay were separated by TLC, developed with chloroform/methanol (95 : 5, v/v) and visualized by autoradiography. The data was quantitated by a PhosphoImager (Bio-Imaging Analyser BAS 2000, Fuji, Japan). Similarly, cells were harvested and assayed for luciferase activity using a dual luciferase assay kit FireLite (Packard; Groninge, BK, Netherland) according to the manufacturer’s instructions. Final luciferase activity was obtained after normalization with Renilla luciferase activity. To investigate the transactivation potential of TfSTAT5 on b-casein-CAT construct via Nb2 PRL-R, 500 ng Nb2 PRL-R expression construct, 500 ng TfSTAT5 or MmSTAT5 expression construct, and 500 ng b-casein- CAT reporter were cotransfected into COS-1 cells. At 24 h after transfection, cells were stimulated or not 1 lgÆmL )1 rat prolactin for a further 24 h. Cell extracts were prepared by using a reported lysis buffer (Promega) and CAT activity was analysed as described above. Results Isolation and genomic organization of the pufferfish STAT5 gene The STAT genes from pufferfish were isolated by PCR amplification using degenerate primers containing sequences corresponding to two stretches of amino acid residues TFWQWFD and GTFLLRF that are conserved among most STAT proteins [52]. Using T. fluviatilis genomic DNA as template, three PCR products were obtained (data not shown). One of these products, 322 bp in length, encodes a portion of the protein that is highly homologous to mammalian STAT5a and STAT5b. This DNA fragment was used as probe to screen a genomic phage library of the round-spotted puffer fish [32,33]. Three positive phage clones, S1, S2 and S3, with similar restriction map, were isolated. The S1 clone was chosen for further characteriza- tion and sequence determination. Fig. 1 summarizes the restriction map of the S1 clone. A total of 11 kb of the T. fluviatilis STAT5 (TfSTAT5) gene was completely sequenced by conventional subcloning strategy in combination with automated sequencing. The complete sequence was deposited in GenBank with an accession number AF307108. To fully characterize the STAT5 transcript, 5¢ and 3¢ RACE were performed to obtain untranslated regions of STAT5 message (data not shown). TfSTAT5 is composed of 19 exons and 18 introns. All exon/intron boundaries identified conformed to the GT/ AG splice donor/acceptor rule [53]. The sizes of the introns varied considerably, ranging from 79 bp (intron 6) to 242 S C. Sung et al. (Eur. J. Biochem. 270) Ó FEBS 2003 1381 bp (intron 1) with an average size of 427 bp (Table 1). The first exon contains the 5¢-untranslated region and the second exon contains the putative translation initiation site (Fig. 1). To investigate further whether there are two related STAT5 genes in the pufferfish genome, we used a pair of degenerate primers, which were derived from two highly conserved regions (677RPKDEVF and 698YVKPQIKQ), to amplify genomic fragments in which the intron sizes are different in mammalian STAT5a and STAT5b. However, we only obtained one PCR product whose sequences were identical to those of TfSTAT5 as mentioned above (data not shown). Sequence comparison and phylogenic analysis In addition, to resolve the genomic structure of TfSTAT5, the full-length cDNA was synthesized by PCR amplifica- tion using first-strand cDNA prepared from T. fluviatilis gill and specific primers designed from the results of 5¢- and 3¢-RACE. After amino acid sequence comparison, TfSTAT5 showed 76% and 78% identity to mouse STAT5a and STAT5b (MmSTAT5a and 5b) and less than 34% to other vertebrate STATs (Table 2). In addition, the 10 C-terminal amino acid sequence of TfSTAT5 is more similar to that of MmSTAT5b than to that of MmSTAT5a. The comparison also reveals that all the major functional domains identified in mammalian STAT proteins are also found in TfSTAT5, including an N-terminal protein interaction domain, coiled-coil domain, DNA-binding domain, SH2 domain, and C-terminal transactivation domain. Furthermore, a tyrosine (Y698) was also identified in the C-terminal transactivation domain that is to be phosphorylated by JAK kinases during activation. As shown in Fig. 2, the N-terminal protein interaction domain, the coiled-coil domain, and C-terminal transactivation domain are encoded by exons 2–5, 5–8, and 17–19, respectively, while the SH2 domain is encoded by exons 15–16 and the DNA-binding domain by exons 9–12. These results suggest that TfSTAT5 and MmSTAT5 proteins displayed conserved features consis- tent with their conservation in genomic structure. Table 1. Exon-intron organization of theTf STAT5gene. Exon no. Exon size (bp) 3¢ end of the exon 5¢ end of the intron Intron size (bp) 3¢ end of the intron 5¢ end of the next exon Amino acid interrupted 1 >24 GAA GGC AAG AG tatgtgtggc 1381 tcccaactag GGT GTT GAA 2 138 GGG CAG CTG TG gtgagtcgcc 270 acgtatgtag G GAT GCA ATT Trp 43 (2) 3 157 AGT CAG CTT AAG gtgagtcttg 1042 tctctttaag AGC ACG TAT Lys 95 (3) 4 90 GAG GCC ACC AAT gtgagtagga 614 tatttaacag TCT AGT TCT Asn125 (3) 5 175 CGT ATC CAG G gtgagtctgt 226 ccccacacag CT CAG CTG TCC Ala184 (1) 6 131 AAA TAC CGA CTG gtaaacccaa 79 atgataccag GAC CTG GCA Leu227 (3) 7 152 CTG CAG TCA TG gtgagttgtc 231 tgcataacag G TGT GAG AAG Trp278 (2) 8 156 CTG GTT ACC AG gtatctgcct 932 ttttctacag C ACC TTT ATT Ser331 (2) 9 80 AAC ACA AGG AA gtaagttcaa 535 tctgccacag T GAA AGC AGT Ans391 (2) 10 88 TTC AGG AAC ATG gtgagtgcct 306 atccttgtag TCC TTG AAG Met420 (3) 11 123 TTT CAA GTG AAG gtaagagagc 172 ctctgcacag ACG TTA TCA Lys461 (3) 12 93 TTT GCA GAG CCG gtgagcacgt 158 ctgtccacag GGT CGG GTG Pro492 (3) 13 207 CAG TTT AAC AGG gtcagcacca 568 ctgtttacag GAG AGT CTT Arg561 (3) 14 95 TGG AAC GAC GG gtaagggaac 172 ttttttttag A GCC ATA CTG Gly593 (2) 15 143 AAC AAA GCA G gtatattcag 434 atgtttccag GT GAG AGA ATG Gly640 (1) 16 156 CCG CCC CTT T gtaagcaacc 139 tcacctaaag CC AAA GCA GTG Ser693 (1) 17 52 GTC GTG CCA GA gtaagtgaca 368 ccgtgcacag G TTT ACT ACA Glu710 (2) 18 108 TAC CCG CCT AT gtaagccact 654 tcctgtccag G AGC GAC TCC Met746 (2) 19 354 ATCCTGGACGCAGACGGAGACTTCG ACCTGGA CGACACCATGGACGTGGC CAGG (the end of the pufferfish STAT5 gene) Fig. 1. Genomic organization of the T. fluviatilis STAT5 gene. Exons are indicated by boxes numbered from 1 to 19. The coding regions are shown as filled boxes whereas the 5¢-and3¢-untranslated regions are shown as open boxes. Introns and the 5¢-and3¢-flanking regions are indicated by solid lines. The restriction map was shown above the genomic structure. Restriction endonuclease sites are B, BamHI;E,EcoRI;H,Hind III; K, Kpn I; S, Sal I; Xb, Xba I; Xh, Xho I. Ó FEBS 2003 Expression and characterization of pufferfish STAT5 (Eur. J. Biochem. 270) 243 To investigate the evolutionary relationship between Tf STAT5 and other STAT family members, the amino acid sequences of highly conserved regions including the DNA-binding domain, linker domain, and SH2 domain of STAT proteins were used to perform phylogenic analyses. As illustrated in Fig. 3, Tf STAT5, MmSTAT5a, MmSTAT5b, MmSTAT6 and Drosophila STAT (DmSTAT) are closely related to each other, constituting a proposed ancient class of the STAT family. In contrast, mouse STAT1, STAT2 analyses suggest that two mam- malian STAT5 genes diverged from a STAT5 locus in teleosts. It has been proposed that in mammals two closely related STAT5 genes resulted from a recently gene duplication [54]. Tf STAT5 mRNA expression The expression pattern of TfSTAT5 mRNA in tissues such as brain, gill, intestine, liver, kidney and testis from adult T. fluviatilis was analysed by RT/PCR. As a negative control, a PCR reaction without RNA was performed. As shown in Fig. 4, a 321-bp DNA fragment could be amplified from all tissues examined. Compared with the expression level of b-actin mRNA, TfSTAT5 was expressed at similar levels in all tissues examined. These results suggested that STAT5 was expressed ubiquitously in T. fluviatilis, consistent with the expression pattern of its mouse homologoue, MmSTAT5a and MmSTAT5b [25]. In vitro translated Tf STAT5-HA-JH1 fusion protein can be tyrosine-phosphorylated and bind to mammalian STAT5 responsive elements The fact that Tf STAT5 protein displayed high similarity in amino acid sequences to Mm STAT5 prompted us to compare the biochemical properties of Tf STAT5 and Mm STAT5. We adopted the method used by Berchtold et al. [55] to generate constitutively active Tf STAT5 variant and to characterize its biochemical properties in acellfreesystem.Thestrategyweusedwastogeneratea fusion protein Tf STAT5-HA-JH1 containing Tf STAT5 and the JH1 domain of the carp JAK1 [43]. The full- length Tf STAT5 cDNA was inserted into a eukaryotic expression vector pcDNA3 with HA-tag (Invitrogen) to generate pTf-STAT5-HA, followed by fusing the JH1 domain (286 amino acids, position 869–1154) of carp JAK1 to the C terminus of Tf STAT5-HA to generate Tf STAT5-HA-JH1. In vitro transcription and translation products of Tf STAT5-HA and Tf STAT5-HA-JH1 can be recognized by mAb against HA (Fig. 5A, lanes 1 and 2). After incubation with mAb PY-99 against phospho- tyrosine, only Tf STAT5-HA-JH1 was reactive to anti- body PY-99 (Fig. 5A, lane 4), demonstrating that the JH1 domain of carp JAK1 could elicit tyrosine phosphoryla- tion activity to autophosphorylate or transphosphorylate Tf STAT5-HA-JH1 in vitro. To further investigate DNA-binding characteristics of Tf STAT5 in vitro, several commercially available mamma- lian DNA-binding motifs for STATs (Santa Cruz, Table 3) were used to perform EMSAs. From these results, Tf STAT5-HA-JH1 displayed specific and strong binding to the ST5 probe (Fig. 5B, lanes 2, 3, and 4) and Int16 probe (Fig. 5B, lanes 6, 7, and 8) which has been found in intron 16 of the T. fluviatilis JAK1 gene [32], but did not bind to other probes ST1, ST3, ST4, ST6, the c-interferon-activated site, and the sis-inducible element (data not shown). Unlabelled or mutant oligonucleotides in a 50-fold excess over radio- active probe were included in the binding reaction to distinguish the binding specificity. The core sequence of ST5 is TTCTAGGAA whereas the core sequence of Int16 is TTCTTGGAA. These sequences resemble the consensus sequence described for human STAT5 (TTCTNA/GGAA) [56]. Table 2. Pairwise amino acid sequence comparisons of Tf STAT5 and other known STATs. All protein sequences were aligned pairwise using the Geneworks nucleic acid and protein sequence analysis software 2.5 from Intelligenetics, Inc. The numbers represent percent amino acid identity. Accession numbers for all sequences are: mouse STAT1 (P42225), STAT2 (AAD38329), STAT3 (P42227), STAT4 (P42228), STAT5a (P42230), STAT5b (P42232), and STAT6 (P52663). Mm STAT5b Mm STAT5a Mm STAT6 Mm STAT1 Mm STAT3 MmSTAT4 Mm STAT2 Tf STAT5 78 76 31 23 25 25 18 Mm STAT5b 91 30 24 25 26 18 Mm STAT5a 30 24 25 25 18 Mm STAT6 19 19 20 20 Mm STAT1 50 50 31 Mm STAT3 45 29 Mm STAT4 29 Fig. 2. Comparison of the exon/intron organization for TfSTAT5, MmSTAT5a,andMmSTAT5b genes. The encoded amino acid sequences, represented by single-letter codes, were aligned using the PILEUP program (Genetic Computer Group). Gaps are introduced to optimize alignment and shown as dashes. Spliced sites are indicated by down-pointing arrowheads. Consensus amino acids (Con) indicate identity in all three sequences. It is obvious that the spliced sites are almost identical. The boundaries of N-terminal protein interaction domains, coiled-coil domains, DNA-binding domains, linker regions and SH2 domains are indicated by arrowed brackets. The tyrosine residue phosphorylated upon activation is indicated by black star. Two pairs of degenerate primers used to probe STAT homologue and explore the second STAT5 gene from T. fluviatilis genomic DNA are indicated by black arrows. Accession numbers for the three sequences are TfSTAT5 (AF307108), MmSTAT5a (AF049104) and MmSTAT5b (AC021632). 244 S C. Sung et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Ó FEBS 2003 Expression and characterization of pufferfish STAT5 (Eur. J. Biochem. 270) 245 Expression and DNA-binding ability of Tf STAT5-HA-JH1 fusion protein in COS-1 cell The expression plasmid pTf-STAT5-HA-JH1 or pTf- STAT5-HA was transiently transfected into COS-1 cells to investigate the expression of Tf STAT5-HA-JH1 fusion protein in mammalian cells. Whole cell lysates were prepared and immunoprecipitated with polyclonal antibod- ies against Tf STAT5, followed by Western blotting with antibodies against HA or PY-99. As shown in Fig. 6A, the fusion proteins of TfSTAT5-HA and TfSTAT5-HA-JH1 were expressed in COS-1 cells (Fig. 6A, lanes 2 and 3), but only TfSTAT5-HA-JH1 could be tyrosine-phosphorylated (Fig. 6A, lane 6). This result indicated that TfSTAT5-HA- JH1 could be constituively active and underwent tyrosine- phosphorylation in COS-1 cells. An EMSA was performed with nuclear extract prepared from COS-1 cells transiently transfected with the expression plasmid pTf-STAT5-HA-JH1 to examine the DNA-binding specificity of the fusion protein TfSTAT5-HA-JH1 in vivo. AsshowninFig.6B,TfSTAT5-HA-JH1 could specifically bind to ST5 and Int16 motifs demonstrating that constitu- tively tyrosine-phosphorylated TfSTAT5-HA-JH1 could elicit DNA-binding activity in vivo. Transactivation potential of Tf STAT5-HA-JH1 fusion protein in mammalian COS-1 cells and carp CF cells To test the transactivation potential of the fusion protein TfSTAT5-HA-JH1, the expression vector pTf-STAT5-HA or pTf-STAT5-HA-JH1 was cotransfected into carp CF cells with a reporter plasmid, p(ST5) 2 -TK-CAT, containing two copies of synthetic ST5-binding motifs upstream of T. fluviatilis TK2 minimal promoter [33]. When the reporter plasmid p(ST5) 2 -TK-CAT was cotransfected with pTf- STAT5-HA-JH1 expression vector, a three- to fourfold increase of CAT activity was observed compared to that of cotransfection with pTf-STAT5-HA expression vector (Fig. 7A). These data indicated that the chimeric TfSTAT5-HA-JH1 protein not only had specific DNA- binding activity, but also had transactivation ability toward an artificial reporter plasmid in fish cells. Furthermore, two reporter plasmids containing the mam- malian b-casein gene promoter or CIS gene promoter were used to evaluate transactivation properties of fusion protein TfSTAT5-HA-JH1. The b-casein gene is the target gene of the PRL-STAT5 signalling pathway [19] and CIS can be induced by the activation of STAT5 [57]. These two genes were originally identified as immediate early genes responsive to cytokine stimulation, which contain STAT5 responsive elements in their promoter regions. Now, they are widely used for evaluation of STAT5 activation in mammals. The b-casein-CAT reporter construct, containing the promoter region ()344 to )1) ofthe b-casein gene and the CAT reporter gene, when cotransfected with pTf-STAT5-HA-JH1, exhib- ited 20-fold and 14-fold increase in CAT activity compared with the cotransfection with pTf-STAT5-HA in COS-1 cells Fig. 3. Phylogenic tree of Tf STAT5 and other STAT family members. The amino acid sequences of DNA-binding and SH2 domains of Tf STAT5 were aligned with those of nine known STAT proteins. The phylogenic tree was constructed by using the NEIGHBOR - JOINING pro- gram together with bootstrap analysis using 1000 replicates provided by CLUSTRAL X . Branch lengths are proportional to sequence diver- gence. Branch labels record the stability of the branches over 1000 bootstrap replicates. GenBank accession numbers of the sequences used are follows: Caenorhabditis elegans (CeSTAT, Z70754); Dro- sophila melanogaster (DmSTAT, Q24151); mouse STAT1 (MmSTAT1, P42225); MmSTAT2 (AAD38329); MmSTAT3 (P42227); MmSTAT4 (P42228); MmSTAT5a (P42230); MmSTAT5b (P42232); and MmSTAT6 (P52633). Fig. 4. Tissue distribution of TfSTAT5 transcripts by RT/PCR. Total RNA (2–5 lg) from tissues of T. fluviatili were subjected to RT/PCR analysis. The resulting PCR products were electrophoresed on 1.2% agarose gel containing ethidium bromide. A negative control was run simultaneously. Top, A DNA fragment of 321 bp was amplified from different tissues using TfSTAT5-specific primers. Bottom, The inten- sity of the 342-bp DNA fragment using b-actin specific primers amplified from T. fluviatili tissues was used to evaluate the relative amount of cDNA used in each PCR. 246 S C. Sung et al. (Eur. J. Biochem. 270) Ó FEBS 2003 and carp CF cells, respectively (Fig. 7B). Similarly, the CIS- Luc reporter construct, containing the promoter region ()646 to )1) of the CIS1 gene and Luc reporter gene, was cotransfected with pTf-STAT5-HA-JH1 or pTf-STAT5-HA in COS-1 cells and CF cells. As shown in Fig. 7C, when the CIS-Luc reporter was cotransfected with pTf-STAT5-HA- JH1, the luciferase activity was increased fourfold and fivefold, in COS-1 cells and CF cells, respectively, compared with that of cotransfection with pTf-STAT5-HA. The transactivation potential of constitutively activated STAT5 isolated from T. fluviatilis towards a CIS-Luc reporter gene in COS-1cells suggested that TfSTAT5 might be functionally equivalent to mammalian STAT5. Moreover, constitutively activated TfSTAT5 can drive the mammalian promoter in fish cells, suggesting that the signalling pathway from STAT5 toward the target gene CIS1 may be conserved between teleosts and mammals. Tf STAT5 was not able to activate b-casein promoter via rat Nb2-PRL-R The in vitro translation product of fusion protein TfSTAT5- JH1 exhibited the same DNA-binding specificity as mam- malian STAT5, and when expressed in COS cells, TfSTAT5-JH1 can activate b-casein and the CIS promoter. However, the full functionality of TfSTAT5 with respect to its mammalian orthologues remains unclear. To address this Fig. 5. Expression, tyrosine phosphorylation and DNA binding of TfSTAT5-HA-JH1 fusion protein in vitro. In vitro transcription and translation products of TfSTAT5-HA (lane 1) and TfSTAT5-HA-JH1 (lane 2) were detected by Western blot analysis (A) using anti-HA mAb (lanes 1 and 2), or anti-phosphotyrosine mAb, PY99 (lanes 3 and 4). In (B), the same product of TfSTAT5-HA-JH1 fusion protein was incubated with labelled probes ST5 (lanes 2–4), and Int16 (lanes 6–8), followed by EMSA. In vitro transcription and translation product of pu-STAT5-HA was used as controls (lanes 1, and 5). Binding is completely abolished by the addition of 50-fold molar excess of cold competitor oligonucleotide (lanes 3 and 7), but remains unchanged when mutant oligonucleotide is added at a 50-fold molar excess (lanes 4 and 8). Table 3. Oligonucleotide sequences used to determine DNA binding specificity of Tf STAT5-HA-JH1. STAT binding motifs are underlined while mutant sequences are indicated by bold. Probe Sequences GAS AAGTACTTTCAG TTTCATATTACTCTA mut. GAS AAGTACTTTCAGTGGTCTATTACTCTA SIE GTGCAT TTCCCGTAAATCTTGTCTACA mut. SIE GTGCATCCACCGTAAATCTTGTCTACA STAT1 CATGTTATGCATA TTCCTGTAAGTG mut. STAT1 CATGTTATGCATATTGGAGTAAGTG STAT3 GATCC TTCTGGGAATTCCTAGATC mut. STAT3 GATCCTTCTGGGCCGTCCTAGATC STAT4 GAGCCTGAT TTCCCCGAAATGATGAGC mut. STAT4 GAGCCTGATTTCTTTGAAATGATGAGC STAT5 AGAT TTCTAGGAATTCAATCC mut. STAT5 AGATTTAGTTTAATTCAATCC STAT6 CCGCTGTTGCTCAATCGAC TTCCCAA GAACA mut. STAT6 CCGCTGTTGCTCAATCGACTAGCCAA GAACA Int16 GCCGTGTAGT TTCTTGGAAATTTCTGG mut. Int16 GCCGTGTAGTTTAGATTAAATTTCTGG Ó FEBS 2003 Expression and characterization of pufferfish STAT5 (Eur. J. Biochem. 270) 247 question, TfSTAT5 or MmSTAT5 was cotransfected with Nb2 PRL-R and b-casein reporter into COS-1 cells. The expression of TfSTAT5 or MmSTAT5 was confirmed by Western blotting (data not shown). Nb2 PRL-R was originally isolated from a pre-T rat lymphoma cell line Nb2 [58]. Compared to long-form prolactin receptor, Nb2 Fig. 7. The fusion protein TfSTAT5-HA-JH1 activates gene expression in COS-1 cells and carp CF cells. Carp CF cells were cotransfected with 1 lg of reporter construct (ST5) 2 -Tyk-CAT and 0.1 lg of expression plasmid encoding TfSTAT5-HA or TfSTAT5-HA-JH1 as indicated (A). Transfection with TK2-CAT reporter was used as the negative control. COS-1 cells and carp CF cells were cotransfected with 0.1 lg expression plasmid encoding TfSTAT5-HA or TfSTAT5-HA-JH1 and 1 lg reporter construct b-casein–CAT (B) or CIS-Luc (C) as indicated. Cell lysates were prepared at 48 h after transfection to determine either CAT activities (A and B) or luciferase activities (C). Transfection efficiency was normalized with the results of a simultaneous b-galactosidase assay. The data obtained were means of three independent experiments, with standard deviations. Fig. 6. Expression, tyrosine phosphorylation and DNA binding of TfSTAT5-HA-JH1 fusion protein in vivo. (A) COS-1 cells were transiently transfected with plasmid pHA-YUN (lanes 1 and 4) as a control, pTf-STAT5-HA (lanes 2 and 5) or pTf-STAT5-HA-JH1 (lanes 3 and 6). Cell lysates were immunoprecipated with an anti-TfSTAT5 antibody, then separated by SDS/PAGE (10% acrylamide) and subjected to Western blot analysis by using anti-HA (lanes 1–3) or antiphosphotyrosine mAb, PY99 (lanes 4–6). (B) COS-1 cells were transiently transfected with expression plasmid encoding pTf-STAT5-HA-JH1. Nuclear extracts were prepared at 48 h after transfection and incubated with labelled probes ST5 (lanes 1– 4), and Int16 (lanes 5–8). Nuclear extracts of COS-1 cells transiently transfected with p-Tf-STAT5-HA served as controls (lanes 1, and 5). A 50-fold excess of unlabelled or mutant oligonucleotides of ST5, and Int16 probes were included in binding reactions as indicated. 248 S C. Sung et al. (Eur. J. Biochem. 270) Ó FEBS 2003 [...]... 5A and 6A) , and exhibited specific DNA-binding activity to the mammalian STAT5- binding element (Figs 5B and 6B) This result indicates that the biochemical properties of TfSTAT5 is conserved with mammalian STAT5, consistent with the highly similar feature in genomic organization and amino acid sequences of STAT5 between mammals and teleosts We further constructed another pTf -STAT5- HA-JH1 consisting of. .. complete genomic structures of human STAT2 and partial STAT1 gene The human STAT2 gene contains 24 exons with genomic structure extremely similar to the STAT1 gene [38] Recently, the genomic structures of mouse STAT3, STAT 5a, STAT5b and zebrafish STAT3 have also been identified and characterized [40] The MmSTAT5b and MmSTAT 5a genes have 19 and 20 exons, respectively, while MmSTAT3 gene has 24 exons From. .. reason that fish STAT5 failed to be activated by mammalian PRL So far, no complete JAK-STAT pathway has been established in fish The only known example of ligandreceptor involved in a K-STAT pathway in fish is prolactin and its receptor The first fish prolactin receptor was cloned and characterized from tilapia [37], and more recently, other fish prolactin receptors have been cloned from goldfish [63] and. .. constitutively activated STATs has been reported Changes of two amino acid residues, H298R and S710F, resulted in a constitutively active STAT5 [60] One mutation is located upstream of the DNA-binding domain (H298R) while the other is in the C-terminal activation domain (S710F) In the case of STAT6, two amino acid residue changes in the SH2 domain (V54 7A and V54 8A) generated a STAT6 mutant that is activated... MmSTAT5 and TfSTAT5 genes are highly conserved in their genomic structure This data is consistent with the result obtained from phylogenic analysis (Fig 3) All mammalian STAT genes are clustered in tandem at three different chromosomes, and this feature is proposed to be the result of successive gene duplication events, and finally, a very recent duplication that led to the formation of tandem STAT 5a. .. domain derived from pufferfish JAK2 [33] to investigate the effect of different JH1 domain on the transactivation potential of the fusion protein This chimeric protein had the same DNA-binding activity towards the STAT5binding motif and the same transactivation activity as the fusion protein with the JH1 domain from carp JAK1 (data not shown) Several components involved in the JAK-STAT pathway have... to a similar level to the long-form of PRL-R [59] As shown in Fig 8, when Nb2 PRL-R was cotransfected with MmSTAT5, CAT activity was increased by fourfold in response to mammalian prolactin stimulation (Fig 8, lane 3 and 4) In contrast, when TfSTAT5 was cotransfected with Nb2 PRL-R, no significant increase in CAT activity was detected (Fig 8 lane 5 and lane 6) This result indicated that TfSTAT5 was... stimulation [61] Moreover, a fusion protein consisting of STAT5 and the kinase domain of JAK2 was also reported to act as a constitutively active form of STAT5 independent of cytokines and their cognate receptors [55] In this study, we first chose the JH1 domain of carp JAK1 [43] to be fused to the C-terminal end of TfSTAT5 The fusion protein showed tyrosine kinase activity and was phosphorylated on... STAT5 (Eur J Biochem 270) 251 transcription factor gene family and confers the prolactin response EMBO J 13, 2182–2191 Liu, X., Robinson, G.W., Gouilleux, F., Groner, B & Hennighausen, L (1995) Cloning and expression of Stat5 and an additional homologue (Stat5b) involved in prolactin signal transduction in mouse mammary tissue Proc Natl Acad Sci USA 92, 8831–8835 Takeda, K & Akira, S (2000) STAT family... 2003 Expression and characterization of pufferfish STAT5 (Eur J Biochem 270) 249 Fig 8 Effects of MmSTAT5 and TfSTAT5 on the trancription of the b-casein promoter via Nb2 PRL-R COS cells were cotransfected with the Nb2 PRL-R expression clone, the b-casein–CAT construct and the STAT construct as indicated At 24 h after transfection, cells were stimulated with or without 1 lgÆmL)1 rat prolactin for another . Sequences GAS AAGTACTTTCAG TTTCATATTACTCTA mut. GAS AAGTACTTTCAGTGGTCTATTACTCTA SIE GTGCAT TTCCCGTAAATCTTGTCTACA mut. SIE GTGCATCCACCGTAAATCTTGTCTACA STAT1 CATGTTATGCATA TTCCTGTAAGTG mut. STAT1 CATGTTATGCATATTGGAGTAAGTG STAT3. CATGTTATGCATATTGGAGTAAGTG STAT3 GATCC TTCTGGGAATTCCTAGATC mut. STAT3 GATCCTTCTGGGCCGTCCTAGATC STAT4 GAGCCTGAT TTCCCCGAAATGATGAGC mut. STAT4 GAGCCTGATTTCTTTGAAATGATGAGC STAT5 AGAT TTCTAGGAATTCAATCC mut AGAT TTCTAGGAATTCAATCC mut. STAT5 AGATTTAGTTTAATTCAATCC STAT6 CCGCTGTTGCTCAATCGAC TTCCCAA GAACA mut. STAT6 CCGCTGTTGCTCAATCGACTAGCCAA GAACA Int16 GCCGTGTAGT TTCTTGGAAATTTCTGG mut. Int16 GCCGTGTAGTTTAGATTAAATTTCTGG Ó