A general form of the Second Main Theorem for hypersurfaces

... FINANCING AUTHORITY (MSBDFA) MSBDFA is a program of the Maryland Department of Business and Economic Development The Department has contracted the administration and management of MSBDFA’s financing ... Treasury David M Porter, Assistant Attorney General, Department of Business and Economic Development W David Rawle, Assistant Attorney General, D...

Ngày tải lên: 06/03/2014, 21:20

... manufacturer GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG ... cystatin A in green and papain in blue Residues in the second binding loop of cystatin A mutated in this work are in red Papain residues involved in interacti...

Ngày tải lên: 17/03/2014, 10:20

... Annals of Mathematics, 168 (2008), 1025–1054 A quantitative version of the idempotent theorem in harmonic analysis By Ben Green* and Tom Sanders Abstract Suppose that G is a locally compact abelian ... refinement of) Ruzsa’s analogue of Freiman’s theorem, which gives a fairly strong characterisation of subsets A ⊆ Fn satisfying a small doubling condition |A...

Ngày tải lên: 22/03/2014, 20:21

... (2005) A profile of the residues in the first intracellular loop critical for Gs-mediated signaling of human prostacyclin receptor characterized by an integrative approach of NMR-experiment and mutagenesis ... further specific ligand- binding information The ligandbinding data for some mutants, such as W17 6A and L172I, showed an increase that was clearly be...

Ngày tải lên: 23/03/2014, 07:20

... A SHARP FORM OF WHITNEY’S EXTENSION THEOREM 513 The following observation is typical of our repeated applications of Helly’s theorem in the proof of Theorem C Let P denote the vector space of ... the order of magnitude of the infimum of the C m norms of all the smooth functions F : Rn → R that agree with f on E A SHARP FORM OF WHITNEY’S EXTENSION TH...

Ngày tải lên: 29/03/2014, 07:20

... understand the structural basis of GluR -A SAP97 interaction, we have determined the crystal structure of SAP9 7PDZ2 in the presence and absence of a GluR -A C-terminal 18-mer peptide ligand The structure ... the wild-type CTD associated with the native SAP97 (Fig 1B) In vitro binding of GluR -A C-terminus to SAP97 PDZ domains To further examine...

Ngày tải lên: 30/03/2014, 10:20

... fibrinogen -binding domains on the aIIb subunit was accomplished and their potential role in platelet aggregation was determined More specifically, a detailed mapping of the aIIb subunit was performed ... 57–64 are potential fibrinogen -binding domains on the aIIb subunit of aIIbb3 and the corresponding peptides inhibit platelet aggregation and antag...

Ngày tải lên: 31/03/2014, 07:20

Ngày tải lên: 05/08/2014, 09:46

... adjacency matrix of the graph is less than ε as long as k ≥ (cε + o(1)) log |G| Their proof involves a clever combinatorial argument that controls the behavior of random walks taken on the ... representations: we write ρ = σ1 ⊕ · · · ⊕ σk If two representations ρ and σ are the same up to an isometric change of basis, we say that they are equivalent It is a fact that an...

Ngày tải lên: 07/08/2014, 08:20

... 12 (2005), #R18 Theorem 2.3 (Aztec diamond theorem) The number of domino tilings of the Aztec diamond of order n is 2n(n+1)/2 Remark: The proof of Proposition 2.1 relies on the recurrence relation ... define a path τi from the center of the left-hand edge of the ith row to the center of the right-hand edge of the ith row Namely, each step of the...

Ngày tải lên: 07/08/2014, 08:22

... denoted Iµ in the literature It turns out that our set of monomials Ah (µ) coincides with the Garsia-Procesi basis B(µ) of monomials for the rational cohomology of the Springer varieties for R := ... [15, Theorem 1.1], the cardinality of the set of i-dimensional (h, µ)-fillings equals the dimension of the degree-2i part of H ∗ (H(X, h)) Therefore, the...

Ngày tải lên: 08/08/2014, 12:23

... fusion assay Env- mediated cell fusion activity was measured using a quantitative vaccinia-based reporter gene assay as described previously [36,37] Each vaccinia virus was used at a multiplicity of ... http://www.retrovirology.com/content/6/1/75 mine whether complementation potential is a more general property of HIV-1 Envs, we analyzed the relative complementation eff...

Ngày tải lên: 12/08/2014, 23:22

... holes uniformly accelerating apart from each other We advocate a new form of the C- metric, which is related to the traditional one by a coordinate transformation It has the advantage that its properties ... related to the ˜ ˜ is related to the acceleration of the black ADM mass of the non-accelerated black holes and A holes ˜ The fact that G(ξ) is a cubic...

Ngày tải lên: 16/09/2015, 15:43

... This completes the proof of Theorem 1.1 References [1] G Dethloff and T V Tan and D D Thai, An extension of the CartanNochka second main theorem for hypersurfaces, Internat J Math 22 (2011), ... are taken in to the account of counting functions) Motivated by the case of hyperplanes, in this paper we generalize Theorem B to the case of arbitrary hypersurfaces,...

Ngày tải lên: 14/10/2015, 08:23