microfluidic devices for cellomics a general overview of the field
A general form of the Second Main Theorem for hypersurfaces
... are taken in to the account of counting functions) Motivated by the case of hyperplanes, in this paper we generalize Theorem B to the case of arbitrary hypersurfaces, and the multiplicities of ... This completes the proof of Theorem 1.1 References [1] G Dethloff and T V Tan and D D Thai, An extension of the CartanNochka second main theorem for hypersurfaces, Internat J Math 22 (2011), ... research is funded by Vietnam National Foundation for Science and Technology Development (NAFOSTED) The first named author was partially supported by Vietnam Institute for Advanced Study in Mathematics,...
- 9
- 254
- 0
Báo cáo khoa học: A structural overview of the PDI family of proteins docx
... ERp57 and the tip of the calreticulin P-domain Proc Natl Acad Sci USA 99, 1954–1959 Satoh M, Shimada A, Keino H, Kashiwai A, Nagai N, Saga S & Hosokawa M (2005) Functional characterization of thioredoxin ... orientation of the bb¢ domains and significant differences in orientation of their a and a domains The catalytic cysteines (orange) of the °C yeast PDI structure face each other (B) The b and b¢ ... Pro138 of the a0 domain restrict access of Arg155 to the Cys-x-x-Cys active site (B) A conformational change in the a domain a2 helix allows Arg270 to enter the hydrophobic core and form a salt...
- 13
- 483
- 0
LIBOR Manipulation: A Brief Overview of the Debate pot
... costs and the statistical methods used to perform the analysis Any defence against an accusation of having manipulated the LIBOR fixing will therefore depend heavily on being able to analyse the ... 17 March 2011 For each maturity, the BBA ranks the 16 rates from highest to lowest and then drops the highest and the lowest The remaining rates are averaged, and this average is reported as the ... distorted, and second that the model of bank costs is an accurate reflection of those costs One cannot tell whether rejection of the hypothesis is because the data are saying that LIBOR was in fact manipulated,...
- 9
- 521
- 0
báo cáo khoa học: " A Guide for applying a revised version of the PARIHS framework for implementation" pdf
... and a set of questions for diagnostic analysis and planning All of the separate components of the actual Guide are contained in additional files (see Additional Files 1, 2, and 4) The main narrative ... need for clear conceptual and operational definitions, measurement approaches, and additional practical information about the realities of application • QUERI frames of reference and concepts affected ... and themed the above information at a two-day intensive face-to-face meeting.) 4) As a group, the authors reached consensus on the above key components, including the clarity/lack of clarity of...
- 10
- 458
- 0
Báo cáo y học: " Complementation of diverse HIV-1 Env defects through cooperative subunit interactions: a general property of the functional trimer" potx
... (0.5% final) and quantified by spectrophotometric measurement of β-galactosidase activity as described previously [36] For each data point, error bars indicate the standard errors of the mean of duplicate ... Institutes of Health research associateship This research was funded in part by the Intramural Program of the NIH, NIAID, including the NIH Intramural AIDS Targeted Antiviral Program References ... insertion of the gp41 N-terminal fusion peptide (FP) into the target cell plasma membrane [14,15] Detailed structural information is not yet available for the native state of gp41, but the structure of...
- 11
- 237
- 0
Báo cáo y học: "Are acupoints specific for diseases? A systematic review of the randomized controlled trials with sham acupuncture controls" pps
... was sufficient to affect the interpretation of results, the risk of bias for the outcome across trails was classified as high [15] Data analysis The trial data were tabulated and then qualitatively ... Search strategy We searched the databases Medline, Embase, AMED, and Chinese Biomedical Database (CBM) in March 2009 The search strategy for the English language databases was an “OR” combination ... that the low quality of the trials may have resulted in an overestimate of the trial outcomes Trials with inadequate random Page of allocation, poor blinding and missing outcome data after randomization...
- 7
- 255
- 0
Báo cáo y học: "Are acupoints specific for diseases? A systematic review of the randomized controlled trials with sham acupuncture controls" pdf
... relational database technology is prevalent in the health care and life science domains, many of the CM databases are currently in the relational format While these relational databases serve the specific ... technology) and then be mapped to the local queries against the underlying relational databases DartGrid [18] is a system demonstrating the use of this semantic web approach to integrate CM databases The ... The advantage of this approach is that existing relational databases and applications accessing these databases need not be abandoned, while new powerful applications can be developed to make...
- 5
- 287
- 0
Báo cáo khoa học: " Characteristics and outcome for admissions to adult, general critical care units with acute severe asthma: a secondary analysis of the ICNARC Case Mix Programme Database" pps
... prognosis of near-fatal asthma A 6-year follow-up study of 145 asthmatic patients who underwent mechanical ventilation for a nearfatal attack of asthma Am Rev Respir Dis 1992, 146:76-81 Evans R III: ... Petheram IS, Branthwaite MA: Mechanical ventilation for pulmonary disease: a six year survey Anaesthesia 1980, 35:467-473 46 Halttunen PD, Luomanmakik K, Takkunen O, Viljanen AA: Management of ... length of stay for admissions to adult, general critical care units in England, Wales and Northern Ireland: the Intensive Care National Audit & Research Centre Case Mix Programme Database Crit Care...
- 10
- 308
- 0
An overview of the EU Member States support schemes for the promotion of renewable energy sources
... Member State may count towards the national overall target of another participating Member State As part of the national policies and measures for the promotion of RES, according to the EU RES policy, ... capacity An example of this case is Italy where the conventional capacity amounted to 71% of the total installed capacity, with a RES-E capacity of 29%, which is 30GW out of 103GW of the total ... where the conventional and nuclear capacity amounted to 67% of the total installed capacity, with a RES-E capacity of 33%, which is 50GW out of 153GW of the total national electric power capacity...
- 14
- 486
- 0
General Overview of Water Quality Modeling
... stages Carefully define the project and model objectives for each stage In general, models are calibrated using data collected at a particular site and verified against another similar data set ... and verification of the water quality model are large and comparable to the data sets required for the water movement component These water quality data sets are seldom available and require ... solutions for the water quality predictions are at least of the same order of magnitude as the water movement predictions The mass balance equation requires averaging over time for a numerical solution...
- 10
- 352
- 0
Overview of the Capital Markets in Vietnamand Directions for Development
... limit the scope of “state capital” that the SCIC will manage; and, Consolidate and industrialize small-scale operations in the private sector and partly adapt the capital market for facilitating the ... Ministry of Finance (MOF) and the State Bank of Vietnam (SBV), among others The Team is grateful to Mr Tran Xuan Ha, Chairman of the SSC, and Mr Pham Phan Dzung, Director of Banking and Financial Institutions ... well as application of sound prudential standards to the financial conglomerates.44 The transformation will call for formalized information sharing and coordination mechanism among financial regulators...
- 71
- 577
- 0
Tài liệu Overview of the Urological and Gynecological Devices Market doc
... Company has received regulatory clearances for sale of the Urgent PC system in the U.S., Canada and Europe • The Company also offer Macroplastique, a urethral bulking agent for the treatment of adult ... data, such as paid databases and information available on the Internet, the accuracy and completeness of such information and the opinions expressed herein cannot be guaranteed Brocair Partners does ... disease and cancers of the urinary tract Private Placement 8.1 6/18/07 Theragenics Corp Operates as a medical device company serving the cancer treatment and surgical markets The Company operates...
- 26
- 553
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart ... Abstart and Ab42stop (5¢-CCTG CCGAGCTCCTATTAAGCGATCACAACGCCACCAA CCATCAG-3¢) and a sequence-verified plasmid carrying the Ab(L1–40) gene This adds Ile41 and Ala42 to the peptide sequence The PCR...
- 16
- 691
- 0
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx
... Klabin and Aracruz that present data for years 2003, 2004 and 2005 and Cenibra which data are available only for 2005 ** The companies not have this value calculated All plants, excepting Aracruz and ... lower than Cenibra in all parameters Votorantim, Suzano Bahia Sul, Ripasa and International paper are integrated producers of the writing and printing paper By calculating the average of the three ... Brazilian companies and comparing with the international Paper performance, the Brazilian group reaches an average lower than foreign subsidiary in five of the six parameters The values reached...
- 23
- 894
- 0
TOWARDS A GENERAL THEORY OF BOND MARKETS pptx
... DGDSWHG SURFHVVHV /HW A EH WKH VSDFH RI VLJQHG PHDVXUHV RQ A HTXLSSHG ZLWK WKH WRWDO YDULDWLRQ QRUP N N9 )RU P A DQG I &A SXW = PI A I t P Gt /HW 0A EH WKH }DOJHEUD JHQHUDWHG ... YDOXHV LQ WKH %DQDFK VSDFH RI FRQWLQXRXV IXQFWLRQV &A ZLWK WKH XQLIRUP QRUP GHQRWHG E\ N N ZKHUH A LV HLWKHU D FRPSDFW VXEVHW RI > @ HJ &A &> 7I @ WKH VSDFH RI DOO FRQWLQXRXV IXQFWLRQV ... PHDVXUDEOH PDSSLQJV l d + A 0A /HW ( E EH WKH VHW RI HOHPHQWDU\ LQWHJUDQGV LH RI SURFHVVHV Q ; W L ,bL d@WL WL @ W PL ZKHUH PL A W W WQ ...
- 33
- 380
- 0
A Joint Publication of the Office of the Attorney General and the Department of Business and Economic Development docx
... set for firms in particular industries The federal government has approved the Occupational Safety and Health Plan of the State of Maryland and has authorized the State to be the enforcement agency ... compensation available includes medical and rehabilitation expenses, a percentage of lost wages, and an amount for impairment of earning capacity The amount of the insurance premiums varies with the ... jurisdiction must participate in the financing, either by guaranteeing at least a portion of the State’s financial assistance or making a loan or grant for the project in an amount equal to at least 10 percent...
- 88
- 487
- 0
A position statement of the National Association for the Education of Young Children docx
... Instead, early childhood professionals draw on all these fundamental ideas (as well as many others) when making decisions about their practice An understanding of the nature of development and learning ... developmental goals The program has a systematic plan for collecting and using assessment information that is integrated with curriculum planning C The methods of assessment are appropriate to the age and ... statement of the National Association for the Education of Young Children Carnegie Task Force on Learning in the Primary Grades 1996 Years of promise: A comprehensive learning strategy for America’s...
- 22
- 1,000
- 0
So, you want to go to grad school in Economics? A practical guide of the first years (for outsiders) from insiders pptx
... graduates who want to apply for an assistant professor position at your department These talks are really helpful to show you the competition among Ph.D graduates, and they may also give you an ... the first year Besides the professors, the TA’s of the courses you are taking in your first year are also an important part of the first year life Don’t hesitate to talk to them Go to their office ... have a competitive knowledge of calculus and linear algebra Familiarity with statistics is also welcome The ideal is to have knowledge of real analysis and some concepts of measure theory The...
- 12
- 696
- 0
Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx
... Surprisal theory The concept of surprisal originated in the field of information theory, as a measure of the amount of information conveyed by a particular event Improbable (‘surprising’) events carry ... the ability of lexicalized surprisal to explain a significant amount of variance in RT data for naturalistic texts, over and above that accounted for by other low-level lexical factors, such as ... accounts for RT, and can thus serve as a measure of the psychological accuracy of each model However, this kind of analysis assumes that RT for a word reflects processing of only that word, The collected...
- 11
- 605
- 0
Monochorionic triamniotic triplet pregnancy with a co-triplet fetus discordant for congenital cystic adenomatoid malformation of the lung ppt
... participated in the design of the manuscript and AC participated in editing of the manuscript YC was the director of the Maternal and Fetal Medicine Unit and participated in the design and revision of ... hospitalization, the vaginal bleeding ceased and the patient was discharged to follow-up A 26 year-old woman was referred to our maternal and fetal unit for detailed ultrasonographic examination ... gestational sac at weeks and ipsilon zone at 15 weeks, and by pathological examination of the placenta after delivery Figure congenital cystic adenomatoid malformation months: cystic masses in the...
- 5
- 484
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25