The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên: 18/02/2014, 11:20

... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...

Ngày tải lên: 07/03/2014, 16:20

... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity...

Ngày tải lên: 23/03/2014, 15:21

... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in...

Ngày tải lên: 30/03/2014, 11:20

... Results Inhibition of PAR-2 expression augments H pyloriinduced cell death and DNA fragmentation in gastric epithelial cells To investigate the relations of PAR-2 expression, cell death, and DNA fragmentation, ... gastric epithelial cells, determined by cell death and DNA fragmentation Inhibition of PAR-2 expression suppresses H pyloriinduced activa...

Ngày tải lên: 18/06/2014, 16:20

... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...

Ngày tải lên: 20/06/2014, 04:20

... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...

Ngày tải lên: 20/06/2014, 07:20

... cytokines than the ContDCs, at 24, 48 h of incubation time (Fig 2) However, the taxol concentration used was critical for the level of cytokine production; μg/ml of taxol induced only marginal ... by that of the β-actin band, and the ratio at h was set at 100% (B) Fig NF-κB involvement in the taxol- induced effects on dendritic cells (DCs) The mobilization...

Ngày tải lên: 07/08/2014, 23:22

... INTRODUCTION Since the early 1960s the vegetation in a number of coastal areas has been affected by a kind of decline which, in terms of both quality and intensity, is very different from the ... trees of P pinea, P tobira, Q ilex and A opalus growing When interpreting the results of the chemical analysis of rainwater and deposits it is necessary to bear...

Ngày tải lên: 08/08/2014, 19:21

... base line level of susceptibility to ischaemia induced injury that can be attributed to mouse strain and muscle fibre type Mast cells independently exacerbate IR injury during a clinically relevant ... mast cells into Wf/Wf mice restores susceptibility to IR injury, thus proving that mast cells play a pivotal role in IR injury to skeletal muscle [5] Our IR...

Ngày tải lên: 11/08/2014, 08:21

... about the special role of any vitamin in COPD could not be obtained Vitamin D and COPD Vitamin D is extremely important for the human body It has a significant role in bone mineralization, in calcium ... COPD [106] Vitamin A and B Vitamin A (retinol and carotens) plays an important role in several functions of the human body including vision, bone and...

Ngày tải lên: 12/08/2014, 13:22

... that p 21/ waf1 and cyclin D2 are complexed together in HTLV -1 infected cells Cell cycle analysis of cyclin D2 and p 21/ waf1 p 21/ waf1 has been previously described as an assembly factor for cyclin ... Cyc D2 CDK2 + CycE + p 21/ waf1 (WT, 10 0ng) D) CDK4 + Cyc D2 CDK2 + CycE B) CDK4 + CycD2 + p16/INK4A CDK4 + CycD2 + p 21/ waf1 (mut) CDK4 + CycD2 + p 21/...

Ngày tải lên: 13/08/2014, 13:20

... percussion injury Keywords: prolonged hemorrhagic shock; fluid percussion injury; nitric oxide; prostaglandin E2; aminoguanidine ix SUMMARY OF THESIS In our study of prolonged hemorrhagic shock, the ... following fluid percussion injury and hemorrhagic shock xv Aims of this thesis is to investigate Pathophysiology of prolonged hemorrhagic shock Role...

Ngày tải lên: 16/09/2015, 15:54

... antagonizing the 5- HT3 receptor slows intestinal transit and that agonizing the 5- HT4 receptor accelerates gastrointestinal transit These observations have led to increased efforts to develop and ... symptomatology of bloating, the role of gastrointestinal transit and effect of tegaserod in non-diarrhea IBS patients with bloating In the...

Ngày tải lên: 26/09/2015, 10:05

... function upstream of the effector caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase- 1, caspase- 4, caspase- 5, caspase- 11 and caspase- 12 ) ... caspase- 1 to an influenza A/ Puerto Rico/8/34 (H1N1) virus infection of RAW264.7 murine macrophages, in vitro To investigate the role of ca...

Ngày tải lên: 13/10/2015, 16:41