The role of caspase 1 in a murine model of influenza pneumon

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên : 18/02/2014, 11:20

15
635
0

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...

Ngày tải lên : 07/03/2014, 16:20

12
595
0

Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf

... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity...

Ngày tải lên : 23/03/2014, 15:21

10
522
0

Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx

... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in...

Ngày tải lên : 30/03/2014, 11:20

13
448
0

Báo cáo hóa học: " Role of protease-activated receptor-2 on cell death and DNA fragmentation in Helicobacter pylori-infected gastric epithelial cells" ppt

... Results Inhibition of PAR-2 expression augments H pyloriinduced cell death and DNA fragmentation in gastric epithelial cells To investigate the relations of PAR-2 expression, cell death, and DNA fragmentation, ... gastric epithelial cells, determined by cell death and DNA fragmentation Inhibition of PAR-2 expression suppresses H pyloriinduced activa...

Ngày tải lên : 18/06/2014, 16:20

7
399
0

báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx

... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...

Ngày tải lên : 20/06/2014, 04:20

8
547
0

báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pdf

... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...

Ngày tải lên : 20/06/2014, 07:20

8
460
0

Báo cáo khoa học: "The role of Bcl-xL and nuclear factor-kB in the effect of taxol on the viability of dendritic cells" ppsx

... cytokines than the ContDCs, at 24, 48 h of incubation time (Fig 2) However, the taxol concentration used was critical for the level of cytokine production; μg/ml of taxol induced only marginal ... by that of the β-actin band, and the ratio at h was set at 100% (B) Fig NF-κB involvement in the taxol- induced effects on dendritic cells (DCs) The mobilization...

Ngày tải lên : 07/08/2014, 23:22

5
335
0

Báo cáo khoa học: " The role of marine salt and surfactants in the decline of Tyrrhenian coastal vegetation in Italy" ppt

... INTRODUCTION Since the early 1960s the vegetation in a number of coastal areas has been affected by a kind of decline which, in terms of both quality and intensity, is very different from the ... trees of P pinea, P tobira, Q ilex and A opalus growing When interpreting the results of the chemical analysis of rainwater and deposits it is necessary to bear...

Ngày tải lên : 08/08/2014, 19:21

11
371
0

Báo cáo y học: "The role of mast cells and fibre type in ischaemia reperfusion injury of murine skeletal muscles" pot

... base line level of susceptibility to ischaemia induced injury that can be attributed to mouse strain and muscle fibre type Mast cells independently exacerbate IR injury during a clinically relevant ... mast cells into Wf/Wf mice restores susceptibility to IR injury, thus proving that mast cells play a pivotal role in IR injury to skeletal muscle [5] Our IR...

Ngày tải lên : 11/08/2014, 08:21

7
400
0

Báo cáo y học: "A systematic review of the role of vitamin insufficiencies and supplementation in COPD" docx

... about the special role of any vitamin in COPD could not be obtained Vitamin D and COPD Vitamin D is extremely important for the human body It has a significant role in bone mineralization, in calcium ... COPD [106] Vitamin A and B Vitamin A (retinol and carotens) plays an important role in several functions of the human body including vision, bone and...

Ngày tải lên : 12/08/2014, 13:22

8
483
0

Báo cáo y học: " The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells" potx

... that p 21/ waf1 and cyclin D2 are complexed together in HTLV -1 infected cells Cell cycle analysis of cyclin D2 and p 21/ waf1 p 21/ waf1 has been previously described as an assembly factor for cyclin ... Cyc D2 CDK2 + CycE + p 21/ waf1 (WT, 10 0ng) D) CDK4 + Cyc D2 CDK2 + CycE B) CDK4 + CycD2 + p16/INK4A CDK4 + CycD2 + p 21/ waf1 (mut) CDK4 + CycD2 + p 21/...

Ngày tải lên : 13/08/2014, 13:20

17
299
0

The role of nitric oxide and prostaglandin e2 in prolonged hemorrhagic shock 1

... percussion injury Keywords: prolonged hemorrhagic shock; fluid percussion injury; nitric oxide; prostaglandin E2; aminoguanidine ix SUMMARY OF THESIS In our study of prolonged hemorrhagic shock, the ... following fluid percussion injury and hemorrhagic shock xv Aims of this thesis is to investigate Pathophysiology of prolonged hemorrhagic shock Role...

Ngày tải lên : 16/09/2015, 15:54

16
212
0

A study of bloating symptomatology, the role of gastrointestinal transit and the response to treatment with the 5 HT4 receptor agonist in patients with bloating predominant irritable bowel syndrome

... antagonizing the 5- HT3 receptor slows intestinal transit and that agonizing the 5- HT4 receptor accelerates gastrointestinal transit These observations have led to increased efforts to develop and ... symptomatology of bloating, the role of gastrointestinal transit and effect of tegaserod in non-diarrhea IBS patients with bloating In the...

Ngày tải lên : 26/09/2015, 10:05

144
356
0

The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

... function upstream of the effector caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase- 1, caspase- 4, caspase- 5, caspase- 11 and caspase- 12 ) ... caspase- 1 to an influenza A/ Puerto Rico/8/34 (H1N1) virus infection of RAW264.7 murine macrophages, in vitro To investigate the role of ca...

Ngày tải lên : 13/10/2015, 16:41

190
824
0