In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel
In vitro and in vivo investigation of nanoparticles of a novel copolymer for substained and controlled delivery of docetaxel
... IN VITRO AND IN VIVO INVESTIGATION OF NANOPARTICLES OF A NOVEL BIODEGRADABLE COPOLYMER FOR SUSTAINED AND CONTROLLED DELIVERY OF DOCETAXEL GAN CHEE WEE (B.Eng (Hons.), NUS) A THESIS SUBMITTED ... many anticancer drugs, including docetaxel, by internalization mechanism of drug-loaded nanoparticles such as endocytic process (Panyam and Labhasetwar, 2003; Bareford and Swaan, 2007) Meanwhile, ... potential biomedical applications, including formulation of imaging agents for cellular and molecular imaging and targeted drug therapy (Zhang et al., 2007; Pan and Feng, 2009) 1.2 Objectives and...
- 163
- 932
- 0
Báo cáo y học: "Non invasive in vivo investigation of hepatobiliary structure and function in STII medaka (Oryzias latipes): methodology and applications" ppsx
... development and application of non invasive in vivo methodologies to the study of biological structure, function and xenobiotic response in STII medaka The development of this in vivo investigatory "system" ... study of piscine biliary transport Collectively these findings demonstrate the ability to study, with high resolution, normalcy and disease/toxicity in vivo in the hepatobiliary system of living ... hepatobiliary architecture Non invasive in vivo imaging in STII medaka allowed the generation of 3D models of the hepatobiliary system (Movies – 9), under conditions of normalcy and toxicity Using LSCM,...
- 26
- 447
- 0
báo cáo khoa học: "Detection of DNA mismatch repair proteins in fresh human blood lymphocytes - towards a novel method for hereditary non-polyposis colorectal cancer (Lynch syndrome) screening" doc
... ATP-dependent interaction of human mismatch repair proteins and dual role of PCNA in mismatch repair Nucleic Acids Research 1998, 26:117 3-1 178 Yamasaki Y, Matsushima M, Tanaka H, Tajiri S, Fukuda R, Ozawa ... proof of principle for this assay, we analyzed fresh blood samples from a population of individuals who are at high risk for having a germline MMR mutation Methods Materials Human colorectal cancer ... proteins in fresh human blood lymphocytes - towards a novel method for hereditary non-polyposis colorectal cancer (Lynch syndrome) screening Journal of Experimental & Clinical Cancer Research...
- 7
- 334
- 0
In vitro and in vivo evaluation of transferrin conjugated lipid shell and polymer core nanoparticles for targeted delivery of docetaxel
... IN VITRO AND IN VIVO EVALUATION OF TRANSFERRIN- CONJUGATED LIPID SHELL AND POLYMER CORE NANOPARTICLES FOR TARGETED DELIVERY OF DOCETAXEL PHYO WAI MIN (M.B.,B.S (YGN) U.M(1)) ... the synthesis and characterization of transferrin conjugated lipid shell and polymer core nanoparticles are discussed in Chapter In Chapter 5, in vitro cellular study of transferrin conjugated LPNPs ... Organization In this thesis, formulations of lipid shell and polymer core nanoparticles are developed for the clinical administration of docetaxel At the same time, the effect of different lipids used in...
- 129
- 286
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...
- 9
- 422
- 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... and cellular responses; and analysis of T-cell proliferation LG contributed to CIA induction and evaluation and to analysis of T-cell proliferation PM contributed to the design of the study and ... inhibition of T-cell proliferation was demonstrated by the addition of inhibitors of these enzymes - GW274150 and indomethacin [8,36], respectively - to the co-cultures The addition of these inhibitors ... Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis Arthritis Research & Therapy 2010 12:R31 Submit your next manuscript...
- 11
- 464
- 0
Báo cáo khoa học: "Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains" pptx
... point, a direct comparison of the pathogenecity of these strains is difficult to make In this context, the aim of the present study is to compare the in vitro and in vivo properties of these two ... to the sensitivity of the ELISA test available In the case of animal 191, as discussed above, the reason could have been the lack of infection Page of Conclusions The in vitro and in vivo properties ... Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains Acta Veterinaria Scandinavica 2011 53:37 Submit your next manuscript to BioMed Central and take...
- 8
- 366
- 0
Báo cáo y học: "In vitro and in vivo evaluation of a new active heat moisture exchange" potx
... Performer and the Hygrobac had significantly higher airway temperature and AH than did the Hygroster (Fig 5) Active Performer, regardless of the level of heating, always had a higher temperature and AH ... inspiratory flow; VT = tidal volume Statistical analysis All data are expressed as mean ± standard deviation For the in vitro study, we compared the three HMEs using a one-way analysis of variance ... evaporation In the present study we assessed the efficiency and stability of this new active moisture exchanger in delivering heat and moisture to inspired gases, as compared with widely used heat and moisture...
- 8
- 360
- 0
In vitro and in vivo study of ABT 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors insight into molecular mechanism and biologic characterization
... In vitro and In vivo study of ABT- 869 in treatment acute myeloid leukemia (AML) alone or in combination with chemotherapy or HDAC inhibitors: insight into molecular mechanism and biologic characterization ... target of STAT3 3.3.9 In vivo efficacy of IDR E804 in combination with ABT- 869 for treatment of MV4-11-R mouse xenografts 69 Discussion 73 References 78 Chapter The combination of HDAC Inhibitors and ... CalcuSyn software for (A) simultaneous combination of ABT- 869 with Ara-C, (B) simultaneous combination of ABT- 869 and Dox , (C) pretreatment with ABT- 869 first followed by Ara-C, (D) pretreatment with...
- 121
- 368
- 0
In vitro and in vivo assessments of PCL TCP composites for bone tissue engineering
... bone tissue engineering for an ideal bone substitute 1.1.3 Strategies in BTE Tissue engineering is the restoration, improvement, maintenance and substitution of damaged tissues and organs using ... will be in solutions (Lakes, 2007) TCP is found naturally in the inorganic phase of bone in form of hydroxyapatite TCP is also responsible for the hardness of bone, dentine and enamel TCP exhibit ... 70-90% of minerals with the rest in the form of proteins Within the proteins in bone, the ratio of collagenous to noncollagenous stands at 9:1 This is in stark contrast with other tissues consisting...
- 94
- 546
- 0
In vitro and in vivo characterisation of recombinant lactobacilli expressing house dust mite allergen
... IN VITRO AND IN VIVO CHARACTERIZATION OF RECOMBINANT LACTOBACILLI EXPRESSING HOUSE DUST MITE ALLERGEN LIEW LEE MEI 2009 IN VITRO AND IN VIVO CHARACTERIZATION OF RECOMBINANT LACTOBACILLI EXPRESSING ... Chapter 4: The in vivo evaluation of the recombinant lactobacilli 97-133 in mouse allergy models 4.1 Introduction 97 4.2 Results 100 The immunogenicity of recombinant lactobacilli in vivo 100 4.2.1.1 ... evaluation of in vivo 101 immunogenicity of the Blo t expressed in recombinant lactobacilli Figure 4.2 Oral feeding of recombinant Lactobacillus plantarum NC8 104 induced the production of Blo t...
- 193
- 613
- 0
In vitro and in vivo evaluation of customized polycaprolactone tricalcium phosphate scaffolds for bone tissue engineering
... submitted for the degree of Master of Engineering in the Department of Mechanical Engineering at the National University of Singapore under the supervision of Professor Teoh Swee Hin and Dr Alvin Yeo ... secrete bone tissue and form the tissue around itself like a protective wall of bone tissue They are responsible for the maintenance of healthy bone by secreting enzymes and directing the bone mineral ... CHAPTER 4: OPTIMIZATION OF NATIVE AND CUSTOMIZED SCAFFOLDS IN VITRO AND THEIR EFFECTS IN INITIAL BONE HEALING 4.1 INTRODUCTION 44 4.1.1 In vitro degradation study 44 4.1.2 In vivo degradation study...
- 143
- 472
- 0
In vitro and in vivo study of vitamin e TPGs coated immunoliposomes for sustained and targeted delivery of docetaxel
... the herceptin conjugated liposomes Thus the herceptin conjugated Vitamin E TPGS coated liposomes showed greater potential for sustained and targeted chemotherapy in the treatment of HER2 over expressing ... have been discovered and developed since the past few decades Together with the problems faced in traditional ways in which cancer patients are treated, this regimen has even become more and ... formulations were provided Then, Chapter presents the preparation and characterization vitamin E TPGS coated and herceptin conjugated liposomes The liposomes were prepared by solvent injection method and...
- 121
- 326
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... stability of PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the ... B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted using...
- 7
- 391
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... lg of protein) were separated by SDS/PAGE using the standard Laemmli system [30] with 13% and 4% (w/w) acrylamide in the separating and stacking gels, respectively In order to estimate the ratio ... they are acidic and presumably located in the cytoplasm like UspA Members of this family share a strikingly similar hydropathy profile (data not shown), and UP12 shares 27% identical and similar ... two proteins GatY and UP12 as putative in vivo substrates of the chaperonin GroEL In addition to its in vivo interaction with GroEL [27], it was shown that GatY aggregates at 42 °C in mutant cells...
- 9
- 548
- 0
Từ khóa: apos apos 8p specific apos apos microarrays two novel metastatic suppressors were identified and proved to suppress in vitro invasion and in vivo metastasis of hccin vitro in vivo extrapolation of drug diffusion velocity and p gp efflux rate parametersoverexpression purification and in vivo reconstitution of hexahistidine tagged wild type and b d186 433 corsearching for in vivo traces of mesenchymal stem cells and their ancestors4 postimplantation remodeling and in vivo recruitment of microvascular networksin vivo models of gut ischemia and inflammationNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ