Impacts of a firms technological diversification on product diversification and performance

... impact of technological and product diversification affect firm financial performance? Management of technological diversification is as complex as that of product diversification so that overdiversification ... Holtz-Eakin et al (1988) and Arellano and Bond (1991) to test the dynamic and bidirectional relationship between technological and product diversif...

Ngày tải lên: 09/10/2015, 11:06

... with attack and release time constants τraise and τdecay The differences between the maxima and minima are calculated to obtain the current dynamic range of the signal (4) The decision for a speech ... vectors containing speech samples will be added to the noise data matrix in (5), which leads to cancellation of parts of the speech signal On the other hand, if t...

Ngày tải lên: 21/06/2014, 08:20

... performance The research focused only on the students‘ difficulties in learning the writing skill and the impact of genre-based approach to their writing performance at Tuyen Quang Gifted High School, Tuyen ... This research method was aimed at providing information on students‘ attitudes towards, and opinions about, the genre-based approac...

Ngày tải lên: 04/08/2015, 09:41

... proportion of additive Results and discussion Genomic validation using German national data Table shows the results of genomic validation based on the national genomic and phenotypic data of German ... Cite this article as: Liu et al.: Impacts of both reference population size and inclusion of a residual polygenic effect on the accuracy o...

Ngày tải lên: 14/08/2014, 13:21

... precision of therapy like the intensity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain ... 14 It was used to investigate whether an intracellular MR imaging is possible and to estimate the T1 relaxivity on MR (1.5 T) Historically already in 1994 electron-spin-resonance...

Ngày tải lên: 26/10/2012, 09:07

... V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of the power system is analyzed using the multi- state system theory According to (2), the universal generating function of the battery ... this paper, and is compared 97 (1) The reliability of the power system obtained by the traditional system reliability theory is always co...

Ngày tải lên: 03/01/2014, 19:38

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên: 18/02/2014, 11:20

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its tar...

Ngày tải lên: 20/02/2014, 11:20

... The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance Robert G Eccles, Ioannis Ioannou, and George Serafeim Abstract We investigate the effect of a corporate ... Supplier Standards Product LCA Human Rights Standards International Standards Compliance National Standards Compliance EMS Environmental Data Availability Envir...

Ngày tải lên: 06/03/2014, 20:21

Ngày tải lên: 09/03/2014, 18:20

Ngày tải lên: 09/03/2014, 22:20

... Protection Agency Of ce of Air and Radiation Policy Feng, T., 1999 Controlling Air Pollution in China: Risk Valuation and the Definition of Environmental Policy New Horizon in Environmental Economics ... air pollution control options but is lacking in China s current policy decision making Our objective is to establish such a link by quantifying the impacts of a...

Ngày tải lên: 15/03/2014, 20:20

... Tsugita & Scheffler [23], and amino-acid analysis was carried out on a Hitachi-835 analyzer (Tokyo, Japan) in the standard mode for protein hydrolysate analysis with cation-exchange separation and ... complex band of valent water OH-bond vibrations is overlapped with peaks of valent OH-bond and NH-bond vibrations of PVX CP Thus, to estimate the state of water mole...

Ngày tải lên: 23/03/2014, 13:20

Ngày tải lên: 23/03/2014, 22:21

... that Richard made his son Richard of Gloucester, captain of Calais; but it appears from Rymer's Foedera, that Richard' s natural son, who was captain of Calais, was called John None of these accounts ... in a situation of personally knowing the transactions of the times; for in one place we are told in a marginal note, that the doctor of the canon law, and o...

Ngày tải lên: 31/03/2014, 21:20