The role of regulatory focus and counterfactual thinking
The role of regulatory focus and counterfactual thinking
... INVESTMENT: THE ROLE OF REGULATORY FOCUS AND COUNTERFACTUAL THINKING SOH CHEN-YII, COLIN M.SC MANAGEMENT, NUS A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE IN MANAGEMENT DEPARTMENT OF MARKETING ... Study 2: The Role of Regulatory Focus on Counterfactual and Semifactual Thinking displayed through Disposition Effect While Study focused on introdu...
Ngày tải lên: 04/10/2015, 16:12
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc
... into antigen-induced arthritis (AIA) mice at day After 24 hours radioactivity in isolated organs and the rest of the body was determined using a γ-counter Thereafter, the total radioactivity recovered ... cells after arthritis induction is not effective On the one hand, transfer of Treg cells 24 hours after intra-articular antigen challenge might be too late to inhib...
Ngày tải lên: 09/08/2014, 06:22
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Research " THE ROLE OF IMPORT SUBSITITUTION AND EXPORT ORIENTATION STRATEGIES ON THAILAND''''ECONOMIC GROWTH " ppt
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf
... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx
... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in...
Ngày tải lên: 30/03/2014, 11:20
the role of labour mobility and informal networks for knowledge transfer
... role in the spillover of knowledge, and ultimately, economic growth ACKNOWLEDGEMENTS This book is the result of the workshop The Role of Labour Mobility and Informal Networks for Knowledge Transfer , ... Retailing and Store Patronage Behavior Davidsson, P Researching Entrepreneurship THE ROLE OF LABOUR MOBILITY AND INFORMAL NETWORKS FOR...
Ngày tải lên: 01/06/2014, 11:20
Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc
... the role of feedback under motor uncertainty, such as is more typical in real-world situations We added random delays to the hand motion before the onset of movement and before the onset of the ... utility of feedforward control We hypothesised that this would increase their dependency on vibrotactile feedback Together these experiments provide a window into the r...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx
... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pdf
... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo toán học: "The role of multidisciplinary research and collaboration for improving the resilience of communities to volcanic risk" pot
Ngày tải lên: 20/06/2014, 21:20
From Conflict to Peacebuilding The Role of Natural Resources and the Environment pdf
... peacebuilding: The role of natural resources and the environment Conflict cycle Role of natural resources and the environment Recommendations Root causes Natural resources play a role in at least ... stability “Environmental security” refers to the area of research and practice that addresses the linkages among the environment, natural res...
Ngày tải lên: 28/06/2014, 19:20