DISCOVERY OF NOVEL REGULATORS OF TYPE i INTERFERON RESPONSE
... the escalating of infection inside the host (Schoggins & Rice, 2011) 15 The ubiquitination mediated regulation of cell signalling The ubiquitin ligases and ubiquitination Ubiquitination is a post ... translational modification of proteins Ubiquitination regulates multiple aspects of protein functioning such as stability, signalling complex formation or dissociation etc Ubiquitination...
Ngày tải lên: 04/10/2015, 16:03
... role in the activation of the salmon IFN promoter, but it cannot act alone to initiate transcription A hallmark of mammalian IFN-a ⁄ b is their rapid induction by virus infection mainly because of ... Atlantic salmon A role for NFjB in the activation of PR -I was further supported by two different inhibitor experiments First, dose-dependent inhibition of promoter activity b...
Ngày tải lên: 07/03/2014, 12:20
... (Figure 1A) This finding is in keeping with the findings of NS1/NS2 antagonism of type I IFNs [4,46,47] and suggests the possibility that type I IFN antagonism is linked to NS1/NS2 induction of ... interfere with direct TLR signaling, but instead regulate paracrine IFN signaling [7] The SOCS protein family is comprised of eight proteins (CIS, cytokine- induci...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
... frequently employ autoantigen microarrays as a screening tool to identify autoantibody reactivities using a multiplex platform and rely heavily on statistical algorithms to determine significant differences ... TLR inhibitors are already being tested in SLE in early-phase human clinical trials Our studies provide a crucial link between the IFN -I system and TLR signaling in...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Inhibitor of IκB kinase activity, BAY 11-7082, interferes with interferon regulatory factor 7 nuclear translocation and type I interferon production by plasmacytoid dendritic cells" ppsx
... inhibitor of IRF7 nuclear translocation and indicates that the inhibition of type I IFN production by BAY1 1 is due to its inhibitory function on the nuclear translocation of IRF7 Unlike type I IFN ... pathogenic conditioned IFN-α production under in vitro experiments BAY1 1 inhibits inducible IFN-α production in vivo Finally, to weigh up the possibility o...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx
... Grutzkau A: Sialic acid-binding Ig-like lectin expression in inflammatory and resident monocytes is a potential biomarker for monitoring disease activity and success of therapy in systemic lupus ... Monocyte surface expression of Fc? receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus Arthritis Re...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: " Improved vaccine protection against retrovirus infection after co-administration of adenoviral vectors encoding viral antigens and type I interferon subtypes" ppsx
... Ad5-based vectors with wild -type or chimeric Ad5/35 fiber encoding murine type I IFN subtypes IFNa1, IFNa2, IFNa4, IFNa5, IFNa6, IFNa9 or IFNb The identities of the IFN subtypes were verified by sequencing ... formation Enhanced antibody titers after co-administration of specific type I IFN subtypes Virus-specific antibodies have been shown to play an important role in...
Ngày tải lên: 13/08/2014, 01:21
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc
... Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipU Cloning of sipV Cloning of sipV Cloning of sipV Cloning of sipV ... Cloning of sipV Cloning of sipV Cloning of sipV Construction of pOpacVh Construction of pOpacVh Cloning of sipW Cloning of sipW Cloning of sipW Cloning of si...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in sus...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo sinh học: " Novel type I interferon IL-28A suppresses hepatitis C viral RNA replication" pptx
... other type I interferons Thus, it is important to thoroughly investigate these interferons, and to explore the possibility of potential clinical application Hepatitis C viral (HCV) infection is ... effect on the IL-28A- induced anti-HCV activity The IL-28A receptor complex consists of a ligand-binding chain, IL-28R, and an accessory receptor chain, IL-10R2 So it is logical to det...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Wild type measles virus attenuation independent of type I IFN" pdf
... ELISA Infection with UV-inactivated virus did not induce antibody production, strongly suggesting that generation of antibodies requires initial replication of G954-V13 after intranasal infection ... http://www.virologyj.com/content/5/1/22 Figure Attenuation of G954 strain is not linked to type IIFN induction Attenuation of G954 strain is not linked to type IIFN induction (A...
Ngày tải lên: 20/06/2014, 01:20
The Discovery of Type II Superconductors Part 1 pdf
... [Ar]3d104s24p3 +III, +V +III, +V +I, +II, +III +II, +III, +IV, +V +III, +V +II, +IV +II, +III, +IV +I, +III +IV, +V, +VI [Xe]4f145d106s26p3 [Ar]3d104s1 [Ar]3d64s2 [Kr]4d35s2 [Xe]4f145d106s26p2 ... Ba1 - xKxBiO3 (8) BiSrCaCu2O6 + x (9) Tl2Ba2Ca2Cu3O9 + x (10 ) HgBa2Ca2Cu3O8 + x (11 ) NdFeAsO1-x Year 19 33 19 67 19 73 19 75 19 86 19 87 19 88 19 88 19 88 19 93 2008 TC 1. 5 6.0 1. 2...
Ngày tải lên: 21/06/2014, 05:20
The Discovery of Type II Superconductors Part 2 pot
... of the applied field for Type I and Type II superconductors; (b) The reversible magnetization curve of a long cylinder of Type I and Type II superconductor (After De Gennes, 1966) In Type II superconductors ... (Аbrikosov, 1957), the idea about the alloys turning into Type II superconductors at the value of the parameter æ > 1/ was first brought fo...
Ngày tải lên: 21/06/2014, 05:20
The Discovery of Type II Superconductors Part 4 potx
... profile which contains the p -type SiQW confined by the δ-barriers heavily doped with boron on the n -type Si (100) surface The value of the critical temperature, Tc= 145 K, the estimations of the ... confine the p -type Si-QW on the n -type Si (100) surface (a) – 77 K; (b) – 4. 2 K Fig 13 Uxx vs the value of the magnetic field applied perpendicularly to the...
Ngày tải lên: 21/06/2014, 05:20