Development of solvent minimized extraction procedures for environmental analysis

... analysis) Notable among recent developments are simple, faster and greener (environmentally friendly) microextraction techniques This thesis focuses on the developments of solvent- minimized extraction ... Supercritical fluid extraction (SFE) is also a very popular technique for environmental analysis It is an appropriate technique for the analysis of the less volatile c...

Ngày tải lên: 04/10/2015, 15:58

... Effect of extraction solvent volume on extraction efficiency Figure 6-5 Effect of type of dispersive solvent and demusification solvent Figure 6-6 Effect of volume of dispersive solvent and demusification ... selection of extraction solvent 124 6.3.2.2 The volume of the extraction solvent 125 6.3.2.3 Selection of dispersive solvent and demulsificati...

Ngày tải lên: 30/09/2015, 06:20

... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the la...

Ngày tải lên: 05/09/2013, 09:38

... Triaxial Testing System, Advanced Triaxial Testing of Soil and Rock, American Society for Testing Materials - Special Technical Publication, ASTM STP 977, pp 82-94, (1988) [6] Miwa Koichi, Nanba ... Itsuo and Tsuneyoshi Akihiko, On the Real Time Processing System for Triaxial Compression Test of Soil, Bulletin of the Faculty of Agriculture, Kagoshima University, p.211-...

Ngày tải lên: 10/12/2013, 06:15

Ngày tải lên: 23/02/2014, 02:20

Ngày tải lên: 15/03/2014, 23:56

... Ó FEBS 20 02 Photoactivatable CRF2 receptor antagonist (Eur J Biochem 26 9) 528 9 [21 ] and astressin [22 ], a conformationally constrained nonselective CRF peptide antagonist [ 12, 23], we were ... USA) was used to monitor radioactivity Photolysis of ATB-[His 12] Svg( 12) 40), and its radioactively labeled analog 125 I-labeled ATB-[His 12] Svg( 12) 40) Photolysis was performed a...

Ngày tải lên: 31/03/2014, 08:20

... RSV-A2 virus and stained with True Blue™ peroxidase substrate The image shows an example of plaque differentiation by automated counting Each "x" represents one plaque counted by the image analyzer ... agreement and equivalence between traditional manual and automated plaque counting methods for detection of RSV neutralizing antibody titers The 180 tests performed...

Ngày tải lên: 19/06/2014, 08:20

... presence and absence of complement and sorted the data by assay, method, and complement treatment The range and mean of the replicate tests are depicted in Fig The difference in the mean of 136 ... agreement and equivalence between traditional manual and automated plaque counting methods for detection of RSV neutralizing antibody titers The 180 tests performed in the presen...

Ngày tải lên: 20/06/2014, 04:20

... Percentage Dose ( %) Figure DVH Comparison of ANFIS and manual planning for a prostate case DVH Comparison of ANFIS and manual planning for a prostate case rized overview of the differences of discrete ... overall planning time While this approach offers a more systematic method to find a suitable plan than sequential optimization with arbitrarily changed constraints, a...

Ngày tải lên: 09/08/2014, 10:20

... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...

Ngày tải lên: 10/08/2014, 05:21

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelof...

Ngày tải lên: 10/08/2014, 21:23

... than descriptive form Templates are created specifically for a particular setting and can be filled in by the reporting physician Synoptic reports are of great value because they ensure that all ... enablers and barriers to the use and sustainability of clinical synoptic reports; and to provide any suggestions or recommendations for implementation and sustainability of the sy...

Ngày tải lên: 11/08/2014, 05:21

... important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and documentation of the MRI; as well as clear communication ... implemented for rectal cancer in North America [16] Aims The specific aims of this project are to develop a synoptic MRI report for primary rectal cancer, and...

Ngày tải lên: 11/08/2014, 16:20

Ngày tải lên: 13/11/2014, 09:34