... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery of didanosine for site ... myristate loaded liposomes J Pharmazie 2005, 60:840-843 37 Uma Maheswari K, Ramachandran T, Rajaji D: Interaction of cisplatin with planar model bilayers - Dose dependent change in electrical characteristics...
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing 39...
... L .A. , Rivier, J.E & Vale, W.W (1999) Comparison of an agonist, urocortin, and an antagonist, astressin, as radioligands for characterization of corticotropin-releasing factor receptors J Pharmacol ... to SDS/PAGE Autoradiography was carried out on a BAS-IP NP 2040P imaging plate Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt) Gel documentation was accomplished ... difference was not statistically significant The photoactivatable antisauvagine-30 analog was shown to be as potent as its parent peptide when stimulating cAMP accumulation alone or suppressing agonist-induced...
... Percentage Dose ( %) Figure DVH Comparison of ANFIS and manual planning fora prostate case DVH Comparison of ANFIS and manual planning fora prostate case rized overview of the differences of discrete ... overall planning time While this approach offers a more systematic method to find a suitable plan than sequential optimization with arbitrarily changed constraints, a Another approach that has already ... smaller for ANFIS-generated plans (by an average of 7.4%) Comparing ANFIS and oFIS for the same cases, PTV coverage was somewhat inferior for ANFIS generated plans, although this was a minor difference...
... we wanted to revalidate the locomotor monitoring system that our research group designed and validated several years ago The new apparatus allows easier recording of animals by means ofa battery ... the aid ofa mechanical object with standardized movement Structure of the apparatus The apparatus was designed for the simultaneous monitoring and recording of 12 individually housed animals Each ... PA, Love S: Doppler shift radar monitoring of activity of rats in a behavioural test situation Physiol Behav 1985, 35:85-87 Parreno A, Saraza ML, Subero C: A new stabilimeter for small laboratory...
... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... Pardanani A, Tefferi A: Clinical correlates of JAK2V617F presence or allele burden in myeloproliferative neoplasms: a critical reappraisal Leukemia 2008, 22:1299-1307 36 Pardanani A, Tefferi A: ... Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Developmentof ET, primary myelofibrosis and PV in mice expressing JAK2 V617F...
... important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and documentation of the MRI; as well as clear communication ... research methods and data analysis Standard principles of qualitative research will be used to sample the participants representing various characteris- Page of (page number not for citation purposes) ... than post-operative chemoradiation [3,4,6] Therefore, accurate staging of rectal cancer at the time of diagnosis is essential in order to assess the need for pre-operative chemoradiation Total...
... important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and documentation of the MRI; as well as clear communication ... research methods and data analysis Standard principles of qualitative research will be used to sample the participants representing various characteris- Page of (page number not for citation purposes) ... than post-operative chemoradiation [3,4,6] Therefore, accurate staging of rectal cancer at the time of diagnosis is essential in order to assess the need for pre-operative chemoradiation Total...
... stream channels Earthquake-weakened soils also triggered large landslides in the cities of Anchorage, Seward, and Valdez In the 1964 Niigata, Japan earthquake, thousands of buildings were damaged ... 10-9 Relative locations of the liquefaction sensor array at Test Location A and the area where a separate crosshole P-wave velocity survey was conducted; Wildlife Liquefaction Array (WLA) (after ... Zeeb Road P.O Box 1346 Ann Arbor, MI 48106-1346 Dedication To my lovely wife Audrey and my two beautiful daughters Kayla and Savannah To my steadfast parents Clayton and Jerri Lynn To all my family...
... research data available for blood cells mean that many of the blood cell population subsets have been isolated by MACS For example, MACS was used for the isolation of plasma cells, which are ... 2008; Makker, Agarwal et al 2008) (Grunewald, Paasch et al 2001; Said, Grunewald et al 2005; Grunewald, Paasch et al 2006) Conflicting observations have also been made Chemotherapy and radiotherapy ... increases the amount of sample obtainable from the same amount of animal tissue Primary cultures have been made of both normal tissue, such as olfactory ensheathing glia and Schwann cells (Franssen,...
... may also serve as a nucleation source for the interaction of intramolecular triple-helical arrays 20 Chapter Many artificial proteins have been prepared by attaching peptide blocks to a template ... establish biomolecular engagement between the material and cell integrin-receptors has gained broad acceptance and appears to have great potential to mimic the many roles of natural proteins (Massia ... necessitate engineering ofa biological substitute for natural collagen, namely a biomimetic collagen to address the drawbacks in the collagen based applications Although works toward realizing collagen-like...
... size of AuNPs increases when HAuCl4/citrate molar ratio increases, but within a range of HAuCl4/citrate molar ratio of 0.3-3.5, the size of AuNPs increases when HAuCl4/citrate molar ratio decreases ... biological phenomena occur at lipid bilayer can also occur at lipid monolayer experimentally The formation of lipid monolayer at air-water and oil-water interfaces typically follows one of two approaches, ... 38] 15 A APES-treated glass B C Figure 2.8 (A) Cartoon of planar anchoring of 5CB on APES-treated glass slide and (B and C) the corresponding optical images of 5CB when the orientation of 5CB...
... parasitic capacitance can be lumped to the main capacitance Another alternative is to use a MOS capacitor, which is actually the gate capacitance ofa MOS transistor As the gate length of CMOS technology ... Class D Power Amplifier A Class D power amplifier uses a pair of transistors as a pair of switches that defines either a rectangular drain voltage or rectangular drain current waveform It also ... operating at Class A, second stage is operating at Class AB and third stage is operating at Class C Last but not least, the final stage is operating as Class D amplifier The final stage transistor...
... ofa team of AUVs has many advantages compared with a single complex AUV A team of AUVs provides redundancy as well as fault tolerance; failure in one of Figure 1.1: Scenario for mission The AUV ... Such a design has several advantages for component construction and maintainability All the components have a uniform software interface to facilitate inter-component communication within the AUV ... an initiative at the Acoustic Research Laboratory (ARL) of the National University of Singapore (NUS) to study collaborative missions carried out by a team of low-cost, modular AUVs The use of...
... Phase map of the test surface 88 Figure 6.8 Images of the background of the test surface after CRA 89 (a) Image of the background of the test surface before displacement 89 (b) Image of the background ... pattern 2.4 Enhancement of Dynamic Range of Optical System An important problem remains in dynamic imaging systems is underexposure ofa CCD sensor in high-speed application At a high frame rate, ... Fourier transformation Compared with the moiré topography, fast Fourier transform method can accomplish a fully automatic distinction between a depression and an evaluation of the object shape It...
... calls for the developmentofa general-purpose system where the teleoperator is shaped and have manipulative capabilities similar to that ofa human Although it is debatable whether a general-purpose ... interpupilary separation) The cameras can also be rotated to provide vergence Human head rotation performance is about a range of 180 degrees and 90 degrees for pan and tilt axes respectively, and a ... VirtualwindoW system (left) to control the DualArm WorkPlatform (DAWP) (right) for D&D operations 2.3.2 Subsea operations The sea occupies a vast area of the earth’s surface and certain parts are often...
... SPINE OF THESIS DEVELOPMENTOF AN INTEGRATED TREATMENT SYSTEMFOR INK EFFLUENT CHUA CHEE YONG 2005 ABSTRACT A characterization study on synthetic wastewaters containing various commercially available ... standard Fenton’s oxidation reaction for treatment TDS and COD were also proposed as critical parameters for the initial assessment of the quality of untreated ink effluents To make way for rapid ... prevalent in collapsing bubbles is crucial The experimental degradation rates fora series of chlorinated hydrocarbons (a pervasive class of water pollutants) as a function of applied ultrasound...