the development of a stem cell therapy for deafness
Báo cáo y học: " Study protocol for the development of a European measure of best practice for people with long term mental health problems in institutional care (DEMoBinc)" pptx
... previous work, we have found that small payments of this kind greatly facilitate the work of researchers and preserve the dignity of participants as partners in research Such an approach has received ... Phase Value for money Analysis of Delphi exercise data of 1–5 Overall ratings are then re-rated by participants Items rated in the top two categories ("essential" and "very important") are collated ... Journal 325: Long term care for serious mental illness outside the NHS: a study of out of area placements Journal of Mental Health 13: A census day audit of mental health out of sector placements...
- 8
- 427
- 0
Báo cáo y học: " The development of a knowledge test of depression and its treatment for patients suffering from non-psychotic depression: a psychometric assessment" ppt
... NOT a recognized treatment for clinical depression? a Medication b Talk therapy c Light therapy (photo -therapy) a Negative thinking that can lead to self-defeating or suicidal behavior b Mental ... occasions to review the items for the following: 1) appropriateness of difficulty and relevancy for patients as examinees, 2) concise, clear language at the appropriate level (Grade 9) and was as ... scientific and ethics board of the University of Calgary granted approval for the study Procedures The design involved the development and the psychometric assessment A table of specification (Table...
- 15
- 416
- 0
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
... template; lane M: DL2000 DNA ladder Maker (TAKARA) ing temperature (Tm) The thermal profile for melting curve analysis consisted of a denaturation for at 95°C, lowered to 55°C for 30 s and then ... and avoids potential cross contamination during sample preparation for post-PCR analysis Real-time RT-PCR assays have been widely utilized for early diagnosis of many other animal viral diseases ... sequence data from the PRRSV N protein gene The partial sequence of the N gene of PRRSV strain ch- 1a was downloaded from GenBank (accession no AY032626) and was aligned (using Clustal W program in the...
- 7
- 350
- 0
Báo cáo y học: " Construction of doxycyline-dependent mini-HIV-1 variants for the development of a virotherapy against leukemias" pps
... (5'TGG AAA GGA CCA GCA AAG CTC CTC TGG AAA GGT 3') and WS3 (5'TAG AAT TCA AAC TAG GGT ATT TGA CTA AT) The same PCR was performed on DNA from a vpU-deletion construct [pDR2484, [39]] The PCR fragments ... (vpU startcodon inactivation) and rtTAΔ6B (vpU deletion) As part of the vpU inactivation strategy, the Y2 6A inactivating mutation in the tat gene of HIV-rtTA is replaced by the wt tat gene of the ... that the Y2 6A mutation, apart from abolishing Tat-TAR mediated transcription, has an additional (small) negative effect on the replication of HIV-rtTA Another possible explanation for the improved...
- 12
- 318
- 0
development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ
... daughters, Kayla and Savannah They have been understanding and extremely patient with me during the writing of this dissertation and my research related travels I love them with all of my heart and cannot ... Location A, Wildlife Liquefaction Array (WLA) 393 Figure 10-9 Relative locations of the liquefaction sensor array at Test Location A and the area where a separate crosshole P-wave ... directly evaluate the liquefaction resistance of soils in place The test is based on the premise of dynamically loading a native soil deposit in a manner similar to an earthquake while simultaneously...
- 542
- 309
- 0
Development of human stem cell based model for developmental toxicity testing
... localization at the periphery and interior of the µ P-hPSC colonies Scale bar, 20 µm in (a, b) (c) Quantification of ppMLC expression at the apical, lateral and basal cellular domains of T+ cells ... approach makes use of the entirety of the data and accounts for data variability The advantage of in vivo animal studies using either rodents or nonrodents compared with all in vitro developmental ... protocols, main applications as well as advantages and drawbacks will be covered for each of the assay 2.3.1 The MM assay The rodent micromass (MM) assay is based on the technique developed by Umansky...
- 165
- 239
- 0
Development of a MACS based strategy for isolating rare cell populations from animal tissue for transcription factor studies
... tissues saves the laboratory a lot of time Commercial preparations are also used when animal facilities are unavailable In other cases, commercial preparations of human tissue RNA circumvent the Page ... blood, and antibodies against known cell surface markers are used for MACS The extensive research data available for blood cells mean that many of the blood cell population subsets have been isolated ... conducted at a cellular level, instead of a tissue level The reference point would then be the transcription profile of that particular cell type in the normal state, rather than the profile of the...
- 382
- 295
- 0
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... [19]-[55] The availability of better CAD tools for the extraction of inductances and capacitances makes the PEEC models attractive PEECs are equivalent to Maxwell’s equations in the limit of an infinite ... resistors and 12 capacitors The ground planes are replaced by the image elements The partial inductance, partial potential coefficient (reciprocal of capacitance) and resistance values are obtained ... potentials The partitioning of geometry is done such that the Inductance patches (current elements) and the capacitance patches (charge elements) are orthogonal and are placed 20 half a cell away...
- 202
- 532
- 0
Lithium-Ion Battery Systems: A Process Flow And Systems Framework Designed For Use In The Development Of A Lifecycle Energy Model
... Spodumene mines can be found in Sweden, Austria, Brazil, Argentina, Canada, Australia, Russia, etc., some of which may or may not be operational (Kunasz, 2006) Australia appears to have the largest spodumene ... below The table compiles the data from the available basins in the world and shows the geologic factor pertaining to each The basic brine basin information table below is taken from the journal article ... reducing the amount of anode in comparison to cathode and can achieve the theoretical capacity of 750 milliAmphours/gram; twice that of the LiC6 composition (Gaines and 23 Cuenca, 2000) Additional...
- 107
- 404
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra were representative of at least three ... critical for the generation of OH• through the Fenton reaction [50] ParA1, PR, PA (ParA1 plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were ... ABA-pretreated leaves could be rescued by the application of ascorbic acid and catalase (Fig 5A, D) The phytopathogenic bacterium Xanthomonas oryzae pv oryzicola (stain RS105), can cause disease in their...
- 15
- 479
- 0
Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt
... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that the ... research effort consists of the development of algorithms for extracting the prosodic information from the speech signal and incorporation of this information into the PARSEC framework In addition, ... incremented by this amount In contrast, Bear and Price, by doubling the size of the grammar are multiplying the processing time by a factor of when no prosodic information is available (assuming (2n)...
- 2
- 359
- 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... may discriminate between the size and charge of the N terminal dipeptide fragment of antisauvagine-30 analogs However, the photoactivatable antisauvagine-30 analog did not cross-link to membrane ... activity of 74 TBqÆmmol)1 Binding and cAMP assay For the determination of the binding affinity and the biological potency of the photoactivatable CRF antagonists, HEK 293 cell lines, stably transfected ... Lin and ¨ Dr Michael G Rosenfeld for providing the HEK-mCRF2b cells Thomas Liepold is acknowledged for the performance of the aminoacid analysis Dr Klaus Eckart is acknowledged for the performance...
- 7
- 344
- 0
báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx
... the basis for the response for each item [9] Cognitive probes elicit information regarding the clarity and rationale of the directions, the meaning of the items, the appropriateness of the response ... scheduled for an interview date At the time of the interview, a trained research assistant obtained parental informed consent and the children signed an assent document All child participants received ... respond to items and talk about all aspects of their health and well-being in meaningful ways They are able to comprehend varying response options on a categorical scale, and can accurately respond...
- 10
- 480
- 1
báo cáo hóa học:" Ovarian cancer plasticity and epigenomics in the acquisition of a stem-like phenotype" pptx
... Targeted therapy to advanced disease and cancer stem cells The rate of mortality in ovarian cancer has changed little in the past three decades [1,2]; drug resistance remains the major therapeutic barrier ... understanding of the normal mechanisms could reveal the aberrant features that mediate and maintain the transformed state, especially in solid malignancies [87,89,98] miRNA as targets and/or mediators ... [33] Early EOC may therefore already possess genetic abnormalities that are further propagated in advanced disease states Normal OSE, early EOC, and advanced disease are easily classified based...
- 11
- 555
- 0
Báo cáo hóa học: "On the feasibility of a channel-dependent scheduling for the SC-FDMA in 3GPP-LTE (mobile environment) based on a prioritizedbifacet Hungarian method" doc
... (for most of the cases) the worst performance In fact for the Figure Assignment algorithms comparison, for a scenario considering the presence of four UE and four RC Medina-Acosta and Delgado-Penín ... out of the scope of this research work) Page of 10 the urban area was utilized for this purpose The time delay and the corresponding average powers in the case of a 12 tap configuration are shown ... http://jwcn.eurasipjournals.com/content/2011/1/71 Page of 10 According to the 3GPP-LTE system, the eNode-B is the one that for each TTI (in our case channel realization) acquires the data about the channel conditions for all the users in...
- 10
- 496
- 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc
... improve its performance The chosen data amount of 22 clinical cases with a median of plan iterations per case led to a sufficient amount of training data for the ANFIS but further data acquisition ... performance of the trained ANFIS For characteristic percentages of isodoses a mean volume reduction for organs at risk (OAR) of 7.4% for ANFIS vs human planner and 3% for ANFIS vs oFIS was achieved ... and the manual plan As a tradeoff, a small area of PTV received higher doses The mean dose to left and right parotids in the ANFIS plan were 20% lower than the ones achieved by the oFIS plan and...
- 16
- 510
- 0
Development of a liposomal nanodelivery system for nevirapine ppsx
... paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate and then dried before it was loaded in the specimen chamber The percentage aqueous ... KHz) was applied using a bath sonicator (UT 002, ABM, India) for the entire duration of the release study For all drug release studies, ml of the release medium was withdrawn for analysis at different ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery of didanosine for site...
- 9
- 359
- 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
... Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will ... initial effects V Analyze pilot study data and prepare manuscripts and future grant proposals CAB = community advisory board; PCARE = primary care, access referral and evaluation 1-3 Cabassa et al ... dominant language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface...
- 12
- 423
- 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle consisting of 94°C for 20 sec, 60°C for 20 sec, and 72°C for 20 sec The final PCR ... details Department of Pathology, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73104, USA 2Oklahoma School of Science and Mathematics, Oklahoma City, Oklahoma 73104, USA 3Edmond ... hospital patients and found nearly 1% of samples to be JAK2V617F positive Hardly any of these patients met the criteria for diagnosis of MPNs, but many of them had other conditions including cardiovascular...
- 7
- 435
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25