Constraint based method for finding motifs in DNA sequences

... (constraint mechanism -based motif finding algorithm) and CRMF (constraint rules -based motif finding algorithm) Both algorithms are based on the use of constraint based motif model introduced in Chapter ... CHAPTER FINDING MOTIF USING CONSTRAIN BASED METHOD that exploits the constraint mechanism to discover motifs Section and are devoted to introduce constraint ru...

Ngày tải lên: 03/10/2015, 21:58

... Kasper, and Irina Temnikova 2004 Multilingual and Cross-lingual news topic tracking In Proceedings of the 20th International Conference on Computational Linguistics (COLING) Ralf Steinberger, Bruno ... Bilingual Text Corpora for CrossLanguage Information Integration In Proceedings of the 2005 ACM SIGKDD International Conference on Knowledge Discovery and Data Mining Thuy Vu, Ai Ti Aw...

Ngày tải lên: 24/03/2014, 03:20

... communication systems In smart antenna systems, the direction of users is an important factor to increase the capacity, and an antenna array is usually used at the base station to estimate and track ... hopping signals, and a new method is proposed to track multipath frequency hopping signals In Chapter 2, several popular methods for DOA estimation are addressed in...

Ngày tải lên: 15/09/2015, 22:51

... the research gap: Can a practical investment project technology evaluation method for post -completion audits in paper production lines based on a self-assessment framework produce information which ... world forest area) Planted forests and new pulp mills as well as paper mills in Asia and South America have changed pulp and paper supply The world’s demand for...

Ngày tải lên: 18/03/2014, 02:20

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...

Ngày tải lên: 21/06/2014, 01:20

... networks including [11] and [12] were discussed only in the link or/and physical layer Conclusion We proposed a TCP window-size delegation method for downlink TXOP Exchange in WLANs In our method, ... · Wid /2 in Equation In Figure 8, window-size delegation increases an increasing slope of Wci (x) in an interval of linear to (1 + a)-fold from Wi(x) If we want to c...

Ngày tải lên: 21/06/2014, 01:20

... values in real datasets Very extreme scenarios, such as extracting all possible combinations of terms that appear in at least one gene (support value of 1), is in many cases a computationally ... out that, in this particular case, the 'protein phosphorylation' category is mainly related to proteins that are involved in cell cycle Indeed, activation and inhibition of many key reg...

Ngày tải lên: 14/08/2014, 17:22

... performance for channel estimation based Alnuaimy-Mahamod 112 interpolation using different techniques of pilot estimation with and without wavelet denoising 5.7 MSE performance for channel estimation ... different interpolation 113 technique using LS technique for pilot estimation combined with wavelet denoising 5.8 MSE performance for channel estimation b...

Ngày tải lên: 26/05/2013, 21:28

... string including errors, and the other is the corresponding correct string (the former string is referred to as the ErrorPart, and the latter as the Correct-Part respectively) These parts ... denotes the length of the input string Step 2: Take the string (Error-String) that comprises an error-block and each M (5 in the experiment) character before and after the err...

Ngày tải lên: 20/02/2014, 18:20

... modified POS tagger, and apply our algorithm to find the translations for words which are tagged as nouns, plural nouns or proper nouns only This produced a more useful list of lexicon and again improved ... j and v is noise We have at this point a segment-aligned parallel corpus with noise elimination Finding low frequency word pairs For the nouns we are interested in find...

Ngày tải lên: 20/02/2014, 22:20

... Recommendations: Evidence is insufficient at this time to establish a defined role for intranasal lidocaine in the management of acute migraine headache (Grade B) • Lidocaine IV Findings: A few small studies ... brain tumor As part of diagnosing migraine, the physician excludes any secondary causes of the patient’s headache In addition, the physician determines...

Ngày tải lên: 21/02/2014, 12:20

... adj prep noun prep det noun adj noun prep noun noun prep noun prep noun n o u n adj noun noun noun noun prep noun noun prep noun prep noun adj noun prep noun adj adj (3) 110 91 74 53 55 73 47 27 ... no-disambiguation for the ten most frequent ambiguous structures are shown in Table (2) (1) noun noun noun noun noun noun noun 573 331 294 260 241 193 160 82 42...

Ngày tải lên: 09/03/2014, 01:20

Ngày tải lên: 09/03/2014, 01:20

... application for anti-spam based on AIS to implement spam detecting And we developed some series experiments Here are the coefficients for the model as the Table showing TABLE I Parameter COEFFICIENTS FOR ... the model utilized a distributed and multi-hierarchy framework to provide an effective solution for the spam Finally, the experimental results show that the proposed model...

Ngày tải lên: 22/03/2014, 22:26

... cannot be used to distinguish mass and count nouns in the writing of learners of English for the purpose of detecting The paper is made of hemp pulp The underlined papers in both sentences cannot ... contains further useful information For example, we can obtain training data consisting of instances of errors by comparing the feedback corpus with its orig...

Ngày tải lên: 23/03/2014, 18:20