Colloidal crystals of nanospheres for protein entrapment
Colloidal crystals of nanospheres for protein entrapment
... techniques of colloidal crystals The vertical deposition method can form large areas of colloidal crystals with the possibility of controlling the thickness of the colloidal crystals formed A substrate ... part of the project, we modify the horizontal deposition method with the aim of optimizing conditions for the formation of colloidal crystals for low conce...
Ngày tải lên: 03/10/2015, 20:58
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc
... process of soybean seeds as decreases in the mRNA levels of GmPDIL-1, GmPDIS-1 [26] and GmPDIM [27] were observed during the accumulation of the storage proteins Expression of certain seed storage proteins ... (2008) A novel plant protein disulfide isomerase family homologous to animal P5: molecular cloning and characterization as a functional protein f...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: 15 N-Labelled proteins by cell-free protein synthesis Strategies for high-throughput NMR studies of proteins and protein–ligand complexes doc
... information, the protein ligand interaction can be probed by [15N]-HSQC FEBS Journal 273 (2006) 4154 – 4159 ª 2006 The Authors Journal compilation ª 2006 FEBS 4157 15 N-labelled proteins by cell-free ... accelerated studies of proteins by NMR spectroscopy by assigning residue type information to every amide cross-peak observed in [15N]-HSQC spectra We anticipate that...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... CTTTGCTACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAGAAA ATTATG-3¢ The resulting 165-bp PCR product contained an Eco105I restriction site (underlined) and an EcoRV (bold) and XbaI ... Clontech, Mountain View, CA, USA) was used and an antirabbit IgG–alkaline phosphatase conjugate (Sigma) as the secondary antibody Microscopy analysis Confocal imaging wa...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx
... show differential tissue-specific distribution of fabp10a and fabp10b transcripts in developing and adult zebrafish, evidence of the divergence of regulatory elements in the promoters of the fabp10a ... vesicles indicates a potential role for this protein in the early development of the zebrafish brain Tissue-specific distribution of fabp10b ge...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
... Fig ATP-binding domain of HSP70 is essential for the inhibition of H2O2-induced activation of caspases-9 and -3 and apoptosis (A) The effects of HSP70 and its deletion mutant proteins on the ... activation Such a mechanism is independent of the interaction of HSP70 with Smac but requires the ATP-binding domain of the protein However,...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTA...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
... defined as physiological substrates for each protein kinase Specifically, protein phosphatase inhibitor-1 was used in the PKA, MAPK, Cdk1 and Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation ... migrating bands are Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation target (Eur J Biochem 271) 3551 Fig Phosphorylation of recombina...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf
... Cellular stress protein responses play a key role in minimizing cell injury and maintaining tissue integrity in response to damaging levels of an environmental agent As such, the integrity of this ... protein to maintain cell integrity The mechanism whereby SEP53 functions as a survival factor is not defined, but is consistent with the function of other un...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Structural model for an AxxxG-mediated dimer of surfactant-associated protein C pptx
... Structure and potential C- terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol Eur J Biochem 271, 2076– 2085 Nilges, M & Brunger, A.T (1993) Successful ... molecular mechanics calculations J Comput Aided Mol Des 5, 5–20 29 Still, W .C. , Tempczyk, A., Hawley, R .C & Hendrickson, T (1990) Semianalytical treatment of solvation f...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt
... Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, the ... be the reason for the lack of linear correlation between protein bilinear indices and stability (tm) for these mutants, leading to a nonlinear depen...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Optimization of conditions for the glycosyltransferase activity of penicillin-binding protein 1a from Thermotoga maritima ppt
... study of the full ectodomain of PBP1a from Thermotoga maritima (Tm -1a* ), extending our previous work on the GTase domain from this protein (Tm-GT1a*) [38] T maritima is a Gram-negative hyperthermophilic ... investigate the substrate specificity of the TPase reaction of Tm -1a* Fig Screening of conditions for GTase activity of CYMAL-4-purified Tm -1a* Tm -...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo sinh học: " Characterization of the protease domain of Rice tungro bacilliform virus responsible for the processing of the capsid protein from the polyprotein" docx
... size of CP subunits is likely the result of retention on the HPLC column due to the very basic charge of the protein; estimated isoelectric point (pI) of CP is 9.43 Localization of the protease domain ... of the RTBV protease Structural modelling of the RTBV protease Structural modelling of the RTBV protease (A), and Rous sarcoma virus (RSV) prote...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Characterization of the protease domain of Rice tungro bacilliform virus responsible for the processing of the capsid protein from the polyprotein" ppt
... size of CP subunits is likely the result of retention on the HPLC column due to the very basic charge of the protein; estimated isoelectric point (pI) of CP is 9.43 Localization of the protease domain ... of the RTBV protease Structural modelling of the RTBV protease Structural modelling of the RTBV protease (A), and Rous sarcoma virus (RSV) prote...
Ngày tải lên: 20/06/2014, 04:20