a homokaryon assay for nucleocytoplasmic shuttling activity of hbv core protein

Methods in molecular biology vol 1540 hepatitis b virus methods and protocols

Methods in molecular biology vol 1540 hepatitis b virus methods and protocols

... (TIGP) in Molecular Medicine, National Yang-Ming University and Academia Sinica, Taipei, Taiwan; Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan Dongliang Yang  •  Department of Infectious ... 5′-GAGTGTGGATTCGCACTCC-­3′, HBV2372R:5′GAGGCGAGGGAGTTCTTCT-3′; For total HBV transcripts: HBV1803F: 5′-TCACCAGCACCATGCAAC-3′, HBV1872R: 5′-AAGCCACCCAAGGCACAG-3′ 2.8  Analysis of HBV cccDNA by qPCR or Southern ... manual (RNA can also be extracted with a column based assay) Digest 500 ng total RNA with 0.5 U DNAase I (Amp Grad) in 10 μL reaction, incubate at RT for 15 min, then add 0.8 μL 2.5 mM EDTA...

Ngày tải lên: 24/12/2016, 22:30

301 1,1K 0
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

... India B (Ba, Bj) C D E F G Southern China (Ba), Taiwan (Ba), Vietnam (Ba), Asians in the USA, Japan (Bj) China (Mainland and Taiwan), Japan, Thailand, Asians in the USA White Caucasians (Southern ... (10-20) Table Geographic Distribution of HBV Genotypes Genotypes Distributions A (Aa, Ae) White Caucasians in Europe, Black Americans in US (Ae), Black Africans, South Africa (Aa), Asia (Aa), India ... Sun CA, Wang LY, et al Hepatitis B e Antigen and the Risk of Hepatocellular Carcinoma New Engl J Med 2002;347:168-174 63 Ishikawa T, Ichida T, Yamagiwa S, Sugahara S, Uehara K, Okoshi S, et al...

Ngày tải lên: 02/11/2012, 11:12

8 643 0
Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"

Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"

... normal levels of alanine aminotransferase, and a fair prognosis However, in Asia, Middle East, Mediterranean basin and southern Europe, about 15% to 20% of these carriers have elevated alanine aminotransferase ... newborns and the completion of a mass vaccination catch up program [10] In Taiwan, the universal hepatitis B vaccination in newborns has both dramatically decreased prevalence of HBsAg as well as incidence ... precore mutants, core promoter mutants, tyrosine-methionine-aspartateC Asia, United States aspartate (YMDD) mutants induced by lamivudine treatment, and asparagine to D India, Middle East, threonine...

Ngày tải lên: 02/11/2012, 11:17

5 450 0
Báo cáo khoa học: "Use of dried blood samples for monitoring hepatitis B virus infection" ppsx

Báo cáo khoa học: "Use of dried blood samples for monitoring hepatitis B virus infection" ppsx

... serum and plasma samples Figure at samples different storage temperatures Viral Load correlation between DBS and plasma matched Viral Load correlation between DBS and plasma matched samples at different ... Ruiz-Tachiquin ME, Valdez-Salazar HA, Juarez-Barreto V, DehesaViolante M, Torres J, Munoz-Hernandez O, et al.: Molecular analysis of hepatitis B virus "a" determinant in asymptomatic and symptomatic ... statistic analysis MTAM participated in the study design, and in drafting and discussing the manuscript All authors have read and approved the final manuscript Authors' information Figure10 graph...

Ngày tải lên: 12/08/2014, 04:20

6 340 0
siRNA, miRNA and their possible roles in molecular therapy of chronic human hepatitis b virus infection and hepatocellular carcinoma

siRNA, miRNA and their possible roles in molecular therapy of chronic human hepatitis b virus infection and hepatocellular carcinoma

... includes an ATPase/RNA helicase domain, two catalytic RNase III domains, a C-terminal dsRNA binding domain (dsRBD) and a conserved PAZ domain which is shared with the Argonaute family that has been ... formation assay (miRNA-182, miR-221, miR-222 and miR-224)…………… 139 XIV LIST OF ABBREVIATIONS AFP Alpha-fetoprotein AMV Avian Myeloblastosis Virus anti-HBcAg Antibody to hepatitis B core antigen anti-HBeAg ... population) Other areas of high incidence rate are Central Africa (~41 per age standardized 100,000 population), Japan (~31 per age standardized 100,000 population), Eastern Africa (~30 per age...

Ngày tải lên: 14/09/2015, 12:11

200 687 0
Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"

Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"

... to 5.97 Baseline group Table The incidence rate ratios computed with multivariate analysis by Poisson regression* Characters Non-Canadian vs Canadian-born Calendar year for non-Canadian-born children ... regression model adjusted for birthplace, age and calendar year, and interactions between birthplace and age, birthplace and calendar year Figure Annual rates of newly identified cases among children ... children Calendar year for Canadian-born children to years vs 10 -15 years for Canadianborn children to years vs 10 -15 years for Canadianborn children to years vs 10 -15 years for nonCanadian-born...

Ngày tải lên: 02/11/2012, 11:08

4 399 0
Báo cáo khoa học: " Selective receptor expression restricts Nipah virus infection of endothelial cells" pot

Báo cáo khoa học: " Selective receptor expression restricts Nipah virus infection of endothelial cells" pot

... with analysis and the interpretation of the data and drafted the manuscript All authors read and approved the final manuscript 17 18 Chua KB, Goh KJ, Wong KT, Kamarulzaman A, Tan PS, Ksiazek ... der, Rota P, bin Adzhar A, White J, Daniels P, Jamaluddin A, et al.: Nipah virus infection in bats (order Chiroptera) in peninsular Malaysia Emerg Infect Dis 2001, 7(3):439-441 Wang L, Harcourt ... TG, Zaki SR, Paul G, Lam SK, Tan CT: Fatal encephalitis due to Nipah virus among pig-farmers in Malaysia Lancet 1999, 354(9186):1257-1259 Yob JM, Field H, Rashdi AM, Morrissy C, Heide B van der,...

Ngày tải lên: 12/08/2014, 04:21

6 169 0
Pharmacoeconomics and health outcomes research for hepatitis b virus infection in singapore

Pharmacoeconomics and health outcomes research for hepatitis b virus infection in singapore

... Pharmacoeconomics and Outcomes Research Healthcare reform and technological advances are creating changes in how health care interventions are evaluated Increasingly, patients and other healthcare providers and ... Cultural Adaptation and Validation of A Health-related Quality Of Life Questionnaire (HRQoL) for English-Speaking Hepatitis B Patients in Singapore Proceeding of ISPOR 12th Annual International ... state……………………… 159 Table 6.4 Summary results of base-case analysis for HBeAg +ve and –ve CHB patients at years………………………………………… 166 Table 6.5 Summary results of base-case analysis for a combination...

Ngày tải lên: 14/09/2015, 09:38

246 193 1
báo cáo hóa học:" High Prevalence of Hepatitis B Virus Markers in Romanian Adolescents With Human Immunodeficiency Virus Infection" ppt

báo cáo hóa học:" High Prevalence of Hepatitis B Virus Markers in Romanian Adolescents With Human Immunodeficiency Virus Infection" ppt

... abdominal distension, nausea, poor appetite and malaise; and absence of abnormal biochemical data: alanine and aspartate aminotransferase less than twice the upper limit of normal, normal serum ... relevant financial relationships Claudia A Kozinetz, PhD, has disclosed no relevant financial relationships Loredana Manolescu, MD, has disclosed no relevant financial relationships Rodica Floarea ... Floarea Matusa, MD, PhD, has disclosed no relevant financial relationships Simona Maria Ruta, MD, PhD, has disclosed no relevant financial relationships Camelia Sultana, MD, has disclosed no relevant...

Ngày tải lên: 20/06/2014, 08:20

7 351 0
Báo cáo y học: " Prevalence of hepatitis delta virus infection among hepatitis b virus surface antigen positive patients circulating in the largest province of pakistan" pptx

Báo cáo y học: " Prevalence of hepatitis delta virus infection among hepatitis b virus surface antigen positive patients circulating in the largest province of pakistan" pptx

... collected samples, epidemiological data, perform all the serological and molecular biology assays and analyzed the data statistically MI, FAM, ZA, IM, MS SY, AT and RH participated in data analysis All ... same reaction mix and amplification conditions using inner sense nucleotides 729-748 (5’-CAACATTCCGAGGGGA CCGT-3’) and inner antisense primers nucleotides 846865 (5’-GAAGGAAGGCCCTCGAGAACAAGA-3’) ... PJ: Natural course and treatment of hepatitis D virus infection J Formos Med Assoc 2006, 105:869-81 Al-Traif A, Dafalla M, Al-Tamimi M, Qassem L: Prevalence of hepatitis delta among HBsAG Carriers...

Ngày tải lên: 12/08/2014, 01:22

5 315 1
Báo cáo y học: " Seropositivity of Hepatitis B virus and Hepatitis C virus dual Infection among blood donors in Nyala Teaching Hospital" pot

Báo cáo y học: " Seropositivity of Hepatitis B virus and Hepatitis C virus dual Infection among blood donors in Nyala Teaching Hospital" pot

... Ponticelli C: Natural history of Hepatitis B and C in renal allograft recipients Transplantation 2005, 79:1132-1136 Kalinowska-Nowak A, Bociaga-Jasik M, Garlicki A, Skwara P: Prevalence of hepatotropic ... 2002, 37:65-68 Ayoola EA, Gadour MO: Hepatocellular carcinoma in Saudi Arabia: role of hepatitis B and C infection Journal of Gastroenterology and Hepatology 2004, 19:665-669 Castillo I, Rodriguez-Inigo ... 15:699-704 Reddy GA, Dakshinamurthy KV, Neelaprasad P, Gangadhar T, Lakshmi V: Prevalence of HBV and HCV dual infection in patients Publish with Bio Med Central and every scientist can read your work...

Ngày tải lên: 12/08/2014, 04:21

2 348 0
Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

... al The Gambia Liver Cancer Study: Infection with hepatitis B and C and the risk of hepatocellular carcinoma in West Africa Hepatology 2004;39:211-219 54 Saito I, Miyamura T, Ohbayashi A, Harada ... Chiba T, Matsuzaki Y, Abei M, Shoda J, Tanaka N, Osuga T, Aikawa T The role of hepatitis B virus infection and heavy smoking in hepatitis C virus-related hepatocellular carcinoma Am J Gastroenterol ... Harada H, Katayama T, Kikuchi S, Watanabe Y, et al Hepatitis C virus infection is associated with the development of hepatocellular carcinoma Proc Natl Acad Sci USA 1990;87:6547-6549 55 Chiba T,...

Ngày tải lên: 02/11/2012, 09:51

6 621 1
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

... Hepatitis B Foundation of America; an Appropriation from the Commonwealth of Pennsylvania USA, Nucleonic Inc (PA USA) Drs Satishchandran C and Cathy Pachuk (Nucleonics Inc, PA, USA), Baohua Gao ... hepatitis B virus envelope are virus neutralizing Vaccine 1986 4(1): 35-7 34 Machida A, Kishimoto S, Ohnuma H, Miyamoto H, Baba K, Oda K, Nakamura T, Miyakawa Y, Mayumi M A hepatitis B surface antigen ... The Hepatitis B virus (HBV), which belongs to the hepadnavirus family, is a small circular DNA virus containing a nucleocapsid and an envelope HBV nucleocapsid contains a relatively small and incompletely...

Ngày tải lên: 03/11/2012, 10:09

13 654 1
Báo cáo khoa học: Betulinic acid-mediated inhibitory effect on hepatitis B virus by suppression of manganese superoxide dismutase expression pot

Báo cáo khoa học: Betulinic acid-mediated inhibitory effect on hepatitis B virus by suppression of manganese superoxide dismutase expression pot

... several biological properties, including antiinflammatory, antiviral, antimalarial, and antimicrobial, as well as impressive anticancer and anti-HIV activities [6–8], although the exact mechanism ... enzymatic activities of caspase-3 and SOD2; (c) superoxide release; and (d) enzymatic activities of alanine aminotranferase and aspartate aminotransferase We found that neither BetA nor PC extract ... plasmid DNA and siRNA were transfected with Lipofectamine Reagent (Invitrogen, Beijing, China) Luciferase activity assays were carried out using the Dual-Luciferase Assay System (Promega), and...

Ngày tải lên: 16/03/2014, 01:20

16 352 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... C54 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ⁄ core+ 1 ... confirm that a comparable total amount of protein was analyzed for each transfectant, the amount of actin in each sample was analyzed by immunoblotting with an anti-actinrabbit polyclonal serum...

Ngày tải lên: 30/03/2014, 03:20

18 365 0
Báo cáo khoa học: Fidelity of hepatitis B virus polymerase pptx

Báo cáo khoa học: Fidelity of hepatitis B virus polymerase pptx

... 5¢-GTT TAT CAG CTT GCT TT-CAA ATA GTC GAA CGA AAG5¢-TGA TAT TCA CAA ACG AA-ACT ATA AGT GTT TGC TTA5¢-TTT TAG ACA GGA ACG GT-AAA ATC TGT CCT TGC CAT5¢-GTT TTC CCA GTC ACG AC-CAA AAG GGT CAG TGC ... single-stranded template Partially doublestranded template-primer structures were created by Table Template/primers used in exonuclease activity assay and sitespecific misinsertion assay Exonuclease activity ... Exonuclease activity assay 5¢-CCC CTA GAA GAA GAA G - 3¢ Primer Template 3¢-GGG GAT CTT CTT CTT AGG ATA GCG-5¢ Site-specific misinsertion assay Primer 1510 G: M13mp18: Primer 2226 A: M13mp18: Primer...

Ngày tải lên: 31/03/2014, 01:20

8 411 0
Báo cáo sinh học: " Common Genotypes of Hepatitis B virus prevalent in Injecting drug abusers (addicts) of North West Frontier Province of Pakistan" doc

Báo cáo sinh học: " Common Genotypes of Hepatitis B virus prevalent in Injecting drug abusers (addicts) of North West Frontier Province of Pakistan" doc

... the samples MMA and SS collected the epidemiological data and wrote the manuscript AN analyzed the data statistically SS and MA performed the serological and molecular assays All the authors have ... 17(2):165-170 Amini- Bavil-Olyaee S, Alavian SM, Adeli A, Sarrami-Forooshani R, Sabahi F: Hepatitis B virus genotyping, core promoter and precore /core mutations among afghan patients infected with hepatitis ... should be at a prime importance as the targets of disease prevention and control programs in Pakistan as they not stay permanently at a particular or specified area and are considered as mobile...

Ngày tải lên: 18/06/2014, 18:20

6 484 0
Báo cáo sinh học: " Hepatitis B virus (HBV) genotypes in Egyptian pediatric cancer patients with acute and chronic active HBV infection" pptx

Báo cáo sinh học: " Hepatitis B virus (HBV) genotypes in Egyptian pediatric cancer patients with acute and chronic active HBV infection" pptx

... antigen [HBeAg] and antibodies to hepatitis B core antigen [anti-HBc]) (enzyme immunoassay [EIA]; Adaltis, Italy) infection were detected with current standard assay All serologic assays were carried ... diagnosed based on the appearance of hepatitis B surface antigen (HBsAg) and the presence of antiHBc-IgM Patients who had HBsAg for more than months with an abnormal alanine aminotransferase (ALT) ... the migration pattern of a 50 lane PCR marker (Promega, Madison, WIs.) Statistical analysis Analysis of data was carried out with the aid of SPSS package version 10.0 Parameters were compared using...

Ngày tải lên: 18/06/2014, 18:20

7 415 0
Báo cáo sinh học: " Serum levels of preS antigen (HBpreSAg) in chronic hepatitis B virus infected patients" potx

Báo cáo sinh học: " Serum levels of preS antigen (HBpreSAg) in chronic hepatitis B virus infected patients" potx

... DNA and ELISA of preS1 antigen J Med Virol 2001, 65(3):493-504 Kobayashi M, Suzuki F, Arase Y, Akuta N, Suzuki Y, Hosaka T, Saitoh S, Kobayashi M, Tsubota A, Someya T, Ikeda K, Matsuda M, Sato ... hepatitis B pre-surface antigen; HBeAg, hepatitis B e antigen, anti-HBs, antibody to HBsAg; anti-preS, antibody to hepatitis B preS antigen; IFN-α, interferonalpha; ALT, alanine aminotransferase ... carrier-state, HBeAg-positive, and HBeAg-negative chronic hepatitis B The inactive HBsAg carrier-state is characterized by the presence of HBsAg and anti-HBe, normal aminotransferase (ALT) level and...

Ngày tải lên: 18/06/2014, 18:20

11 540 0
Báo cáo sinh học: " Cellular apoptosis induced by replication of hepatitis B virus: possible link between viral genotype and clinical outcome" pptx

Báo cáo sinh học: " Cellular apoptosis induced by replication of hepatitis B virus: possible link between viral genotype and clinical outcome" pptx

... Expression of viral microRNAs in Epstein-Barr virus-associated gastric carcinoma J Virol 2007, 81(2):1033-1036 Matsushita T, Okada T, Inaba T, Mizukami H, Ozawa K, Colosi P: The adenovirus E 1A and E1B19K ... virus surface antigen mutants in Singapore patients with hepatocellular carcinoma and hepatitis B virus carriers negative for HBsAg but positive for anti-HBs and anti-HBc J Gastroenterol Hepatol 2002, ... KS, Hu CP, Tsai CH, Lo SJ, Chang C: Identification and characterization of a structural protein of hepatitis B virus: a polymerase and surface fusion protein encoded by a spliced RNA Virology 2000,...

Ngày tải lên: 18/06/2014, 18:20

5 363 0
w