Cloning, characterisation and functional analysis of horseshoe crab c reactive proteins

... 5’-AGAATTCCTGTGTGCATCATTCG-3’ CrCRP-2R 5’-AACAGCTCGAGGAACAGTGAAAAATTC-3’ CrCRP-1F 5’-CCGGATCCCTTAAATTTCCTCCGTCTA-3’ CrCRP-1R 5’-CTAATACGAATTCTAAGCACAGATT-3’ Purpose Forward primer for PCR/ cloning of ... 121 41 TTCTCCGTCATTCCCGCGACTAGTAATGGTGGGAACGTTACCTGATCTGCAAGAAATTAC S P S F P R L V M V G T L P D L Q E I T CrCRP-2F-2Æ CTTATGTTACTGGTTCAAAATTCATCGCTTAAAGGCCTCACTTCATATGTTTTCGTACGC L C Y...

Ngày tải lên: 03/10/2015, 20:57

... the cuticular extract Purification of chitin-binding proteins Fig TGase-dependent protein cross-linking of cuticular chitinbinding proteins Lane 1, nontreated cuticular proteins; lane 2, cuticular ... Y9), and repeats of the di- and tri-peptide sequences QQ and QQQ were observed in the amino terminal sequences of basic QH proteins and 10 Nucleotide sequences...

Ngày tải lên: 07/03/2014, 21:20

... Results Cloning of the 5¢-upstream region of the Pokemon gene To identify the regulatory sequences that control expression of the Pokemon gene, a 2204-bp section of the 5¢-upstream region of the Pokemon ... mechanisms of the Pokemon gene Computer analysis of putative transcription factor-binding sites For a rough understanding of the re...

Ngày tải lên: 30/03/2014, 04:20

... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further inves...

Ngày tải lên: 20/02/2014, 02:21

... to the cytosol Here we confirm and extend earlier studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction The interaction of Pex1p ... for the Pex1p Pex6p interaction and their functional role in peroxisome biogenesis Results The contribution of Pex1p and Pex6p to peroxisomal bioge...

Ngày tải lên: 07/03/2014, 16:20

... Detection of zebrafish SULT1 ST1 and ST2 mRNAs and (B) Western blot analysis of zebrafish SULT1 ST1 protein (A) Detection of zebrafish SULT1 ST1 and ST2 mRNAs in cultured zebrafish cells (lanes and 3) and ... sequence of zebrafish SULT1 ST1 displayed, respectively, 50%, 50%, and 49% identity to those of mouse SULT1C1, rat SULT1A1, and human SULT1A1 STs [22...

Ngày tải lên: 08/03/2014, 02:20

... report on the isolation of four new monoterpene synthase cDNAs by random sequencing of a flavedo-derived cDNA library of C limon and their characterization by functional expression in Escherichia ... sabinene, a-terpinene (E )-b-ocimene, terpinolene, linalool and a-terpineol cDNA isolation and sequencing Random sequencing of a cDNA library made from mRNA isolate...

Ngày tải lên: 08/03/2014, 23:20

... like the Trp residue of the 183 Conformation, ligand binding and distribution of nematode protein Ag-NPA-1 R Jordanova et al Fig Immunohistological localization of Ag-NPA-1 in adult A galli and ... ligand binding and distribution of nematode protein Ag-NPA-1 Fig Immunogold electron microscopic localization of Ag-NPA-1 in a male A galli worm (A) Sect...

Ngày tải lên: 16/03/2014, 18:20

... b5 strand) of D3 and F27/Y289 (b2 strand), L67/M324, V70/I327 and L72/L328 (all in b4 strand) of B The second cluster consists of P6/M267, L10/ L271 (both in a-helix), V18/C279 (b1 strand), L32/F293 ... solution structures of the UBL domain of hHR23A/B bound to a UIM peptide of S5a [99,119] could be used to model the complex of hHR23A/B and ataxin-3 Similarly, the comple...

Ngày tải lên: 30/03/2014, 15:20

... expression of WC1N3 and WC1-N4 isoforms and expression of families of the γδ TCR that express determinants TCR1-N6, TCR1N7, or TCR1-N6 and -N7 Only a subset of WC1- γδ T cells expressed a form of TCR1 ... Determination of the antigenic phenotype and frequency of subsets of WC1+ and WC1- γδ T cells in peripheral blood and lymphoid tissues: i) Flow cytometric...

Ngày tải lên: 07/08/2014, 14:22

... available on HIV-1 subtype C RRE genetic and functional characteristics In the present study, we present in-depth genetic and functional analysis of RRE sequences from a cohort of 13 HIV-1 infected ... between HIV-1 subtypes B and C and with probably other subtypes as well The analysis of intra-subtype divergence (genetic distance from Page of Indian c...

Ngày tải lên: 10/08/2014, 05:21

... silencing by microRNAs is highly conserved in plants and specifically targets all of the HD-Zip III genes through the binding of mir165/166 [19] Functional analyses of HD-Zip III genes in herbaceous ... redundancy The aim of this study was to develop insights into the role of HD-Zip III genes in secondary xylem formation in forest trees We examined th...

Ngày tải lên: 11/08/2014, 11:21

... STRUCTURAL AND FUNCTIONAL ANALYSIS OF CRITICAL PROTEINS INVOLVED IN mRNA DECAY CHENG ZHIHONG (B.Sc) Ease China University of Science and Technology A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR ... deadenylation, decapping and degradation of the mRNA body Three proteins, hUpf1, Dhh1 and Ski8 involved in eukaryotic mRNA decay were structurally and f...

Ngày tải lên: 14/09/2015, 22:22

... synthesize first 29 strand cDNA as well as whole p53 gene The 5’ end of the forward primer starts from the start codon of p53 gene and in case of reverse primer the 5’ end starts just after the ... Regulation of p53 dependent DNA-repair target gene promoters 60 by p53Pro and p53Arg variants VI 3.2.2.1 Expression of Gadd45 promoter in presence of either...

Ngày tải lên: 15/09/2015, 17:10

... influence of kinesin-1 on the delivery of NCAM to the cell surface in CHO cells 55 Fig 12: Functional analysis of the influence of kinesin-1 on the delivery of NCAMCT to the cell surface ... kinesin-1 and kinesin light chain 13 Fig 4: Analysis of the purification fractions and the concentrate of hNCAM180ID 41 Fig 5: Analysis of the purificatio...

Ngày tải lên: 25/11/2015, 13:27