Cloning, characterisation and functional analysis of horseshoe crab c reactive proteins

... 5’-AGAATTCCTGTGTGCATCATTCG-3’ CrCRP-2R 5’-AACAGCTCGAGGAACAGTGAAAAATTC-3’ CrCRP-1F 5’-CCGGATCCCTTAAATTTCCTCCGTCTA-3’ CrCRP-1R 5’-CTAATACGAATTCTAAGCACAGATT-3’ Purpose Forward primer for PCR/ cloning of ... 121 41 TTCTCCGTCATTCCCGCGACTAGTAATGGTGGGAACGTTACCTGATCTGCAAGAAATTAC S P S F P R L V M V G T L P D L Q E I T CrCRP-2F-2Æ CTTATGTTACTGGTTCAAAATTCATCGCTTAAAGGCCTCACTTCATATGTTTTCGTACGC L C Y W F K ... Q C P N K I H I G R CrCRP-2F-3Æ GTGGCATCATGCATGTCACACGTGGTCATCATGGAAAGGTGAGGCGACTACAAACGTGGA W H H A C H T W S S W K G E A T T N V D 361 121 TGGTTTCCATTGTGTAGGTAACGCAACTGGAATCGCCACGGGAGCTACTCTTCGTCAAGG...

Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx

... the cuticular extract Puriﬁcation of chitin-binding proteins Fig TGase-dependent protein cross-linking of cuticular chitinbinding proteins Lane 1, nontreated cuticular proteins; lane 2, cuticular ... Y9), and repeats of the di- and tri-peptide sequences QQ and QQQ were observed in the amino terminal sequences of basic QH proteins and 10 Nucleotide sequences of HMM chitin-binding proteins cDNA ... [28,29] In order to identify novel cuticular chitin-binding proteins and cuticular proteins involved in innate FEBS Journal 272 (2005) 4774–4786 ª 2005 FEBS Cuticular proteins in horseshoe crabs...

Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx

... Results Cloning of the 5¢-upstream region of the Pokemon gene To identify the regulatory sequences that control expression of the Pokemon gene, a 2204-bp section of the 5¢-upstream region of the Pokemon ... mechanisms of the Pokemon gene Computer analysis of putative transcription factor-binding sites For a rough understanding of the regulation of the Pokemon gene, the 2204-bp section of its 5¢-upstream region ... 2008 The Authors Journal compilation ª 2008 FEBS 1861 Analysis of upstream region of the Pokemon gene Y Yang et al Fig Nucleotide sequence of the 5¢-upstream region of the Pokemon gene The upstream...

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further investigation of the biological function of ... Fig Hydropathy plot of putative IL-10 proteins from carp, torafugu and human The x-axis denotes the residue position and the y-axis represents hydrophobicity The hydrophobicity analysis was carried...

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... to the cytosol Here we conﬁrm and extend earlier studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction The interaction of Pex1p ... for the Pex1p Pex6p interaction and their functional role in peroxisome biogenesis Results The contribution of Pex1p and Pex6p to peroxisomal biogenesis is well established on the basis of the ... revealed the presence of Pex6p in the precipitate of full-length Pex1p ProtA and also the presence of Pex1p in the full-length Pex6p ProtA-precipitate (Fig 1C,D) These data conﬁrm the in vivo interaction...

Báo cáo khoa học: Sulfation of hydroxychlorobiphenyls Molecular cloning, expression, and functional characterization of zebraﬁsh SULT1 sulfotransferases docx

... Detection of zebraﬁsh SULT1 ST1 and ST2 mRNAs and (B) Western blot analysis of zebraﬁsh SULT1 ST1 protein (A) Detection of zebraﬁsh SULT1 ST1 and ST2 mRNAs in cultured zebraﬁsh cells (lanes and 3) and ... sequence of zebraﬁsh SULT1 ST1 displayed, respectively, 50%, 50%, and 49% identity to those of mouse SULT1C1, rat SULT1A1, and human SULT1A1 STs [22] The deduced amino acid sequence of zebraﬁsh SULT1 ... of the regulation of the activity of the zebraﬁsh ST by these divalent metal cations and their modes of action Fig Eﬀects of divalent metal cations on the sulfating activity of the zebraﬁsh SULT1...

Báo cáo Y học: Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases pot

... report on the isolation of four new monoterpene synthase cDNAs by random sequencing of a ﬂavedo-derived cDNA library of C limon and their characterization by functional expression in Escherichia ... sabinene, a-terpinene (E )-b-ocimene, terpinolene, linalool and a-terpineol cDNA isolation and sequencing Random sequencing of a cDNA library made from mRNA isolated from the peel of young lemon fruits ... of identity of the lemon monoterpene synthases indicate that they should be grouped within the tpsb clade of the angiosperm monoterpene synthases (Fig 1, and Table 1) [34] Although the four lemon...

Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

... like the Trp residue of the 183 Conformation, ligand binding and distribution of nematode protein Ag-NPA-1 R Jordanova et al Fig Immunohistological localization of Ag-NPA-1 in adult A galli and ... ligand binding and distribution of nematode protein Ag-NPA-1 Fig Immunogold electron microscopic localization of Ag-NPA-1 in a male A galli worm (A) Section of the striate musculature (mu) and the ... emission upon binding characterize the binding sites of NPAs as highly nonpolar and completely isolated from the solvent Here we analyze the conformational and functional properties of Ag-NPA-1 as...

Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

... b5 strand) of D3 and F27/Y289 (b2 strand), L67/M324, V70/I327 and L72/L328 (all in b4 strand) of B The second cluster consists of P6/M267, L10/ L271 (both in a-helix), V18/C279 (b1 strand), L32/F293 ... solution structures of the UBL domain of hHR23A/B bound to a UIM peptide of S5a [99,119] could be used to model the complex of hHR23A/B and ataxin-3 Similarly, the complex of a UIM of ataxin-3 with ... detailed analysis of ataxin-2 homologues including the yeast homologue Pbp1, using a structurebased multiple sequence alignment of Sm and Sm-like proteins and a 3D model of the Lsm domain of ataxin-2...

Báo cáo khoa học: "Phenotypic and functional analysis of bovine γδ lymphocytes" pps

... expression of WC1N3 and WC1-N4 isoforms and expression of families of the γδ TCR that express determinants TCR1-N6, TCR1N7, or TCR1-N6 and -N7 Only a subset of WC1- γδ T cells expressed a form of TCR1 ... Determination of the antigenic phenotype and frequency of subsets of WC1+ and WC1- γδ T cells in peripheral blood and lymphoid tissues: i) Flow cytometric analysis: Analysis of the tissue distribution of ... selected time points and processed for FC and preparation of mRNA For sorting, the cells were labeled Phenotypic and functional analysis of bovine γδ lymphocytes Table List of mAbs used in this...

Báo cáo y học: " Genetic and functional analysis of HIV-1 Rev Responsive Element (RRE) sequences from North-India" pdf

... available on HIV-1 subtype C RRE genetic and functional characteristics In the present study, we present in-depth genetic and functional analysis of RRE sequences from a cohort of 13 HIV-1 infected ... between HIV-1 subtypes B and C and with probably other subtypes as well The analysis of intra-subtype divergence (genetic distance from Page of Indian consensus sequence) and diversity (intra-subtype ... amounts of Rev protein and subjected to EMSA as described earlier [18] Results and discussion Analysis of RRE nucleotide sequences 83 sequences of subtype B (from USA, Japan, Mayanmar, France and...

báo cáo khoa học: "Gene family structure, expression and functional analysis of HD-Zip III genes in angiosperm and gymnosperm forest trees" pps

... silencing by microRNAs is highly conserved in plants and specifically targets all of the HD-Zip III genes through the binding of mir165/166 [19] Functional analyses of HD-Zip III genes in herbaceous ... redundancy The aim of this study was to develop insights into the role of HD-Zip III genes in secondary xylem formation in forest trees We examined the HDZip III gene family in two unrelated tree ... neofunctionalisation or subfunctionalisation within the angiosperms Transcription profiles identify HD-Zip III putatively involved in vascular development Delineating the potential role of HD-Zip...

Structural and functional analysis of critical proteins involved in mRNA decay

... STRUCTURAL AND FUNCTIONAL ANALYSIS OF CRITICAL PROTEINS INVOLVED IN mRNA DECAY CHENG ZHIHONG (B.Sc) Ease China University of Science and Technology A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR ... deadenylation, decapping and degradation of the mRNA body Three proteins, hUpf1, Dhh1 and Ski8 involved in eukaryotic mRNA decay were structurally and functionally studied in this thesis Ski8 ... include the poly(A)-binding protein (Pab1) and the cap-binding protein (eIF4E) Pab1 couples decapping with deadenylation and inhibits decapping by promoting the formation of the translation initiation...

Regulation and functional analysis of the tumor suppressor gene product, p53

... synthesize first 29 strand cDNA as well as whole p53 gene The 5’ end of the forward primer starts from the start codon of p53 gene and in case of reverse primer the 5’ end starts just after the ... Regulation of p53 dependent DNA-repair target gene promoters 60 by p53Pro and p53Arg variants VI 3.2.2.1 Expression of Gadd45 promoter in presence of either p53Pro 60 or p53Arg 3.2.2.2 Expression of p53R2 ... 1992) Because of these properties, p53 gene is considered as a “guardian of the genome” p53 protein lies at the heart of stress response pathways that prevent the growth and survival of potentially...

Identification of novel cytosolic binding partners of the neural cell adhesion molecule NCAM and functional analysis of these interactions

... influence of kinesin-1 on the delivery of NCAM to the cell surface in CHO cells 55 Fig 12: Functional analysis of the influence of kinesin-1 on the delivery of NCAMCT to the cell surface ... kinesin-1 and kinesin light chain 13 Fig 4: Analysis of the purification fractions and the concentrate of hNCAM180ID 41 Fig 5: Analysis of the purification fractions and the concentrate of hNCAM140ID ... Human NCAM Human NCAM with deleted intracellular domain Intracellular domain of human NCAM isoform 140 Human NCAM isoform 180 Intracellular domain of human NCAM isoform 180 Extracellular domain of...

Xem thêm

Từ khóa: brachypodium distachyon a new model system for structural and functional analysis of grass genomes cloning sequencing and restriction analysis of viral elutes from fta cloning expression pattern and phylogenetic analysis of the lysyl trna synthetase gene from the chinese oak silkworm antheraea pernyi out of the green yonder molecular cloning and functional characterization of beta carotene 15 15 apos oxygenases amplification cloning and sequence analysis of the complete env genes of a wide variety of srv 2 isolates cloning prokaryotic expression and antigenicity analysis of the recombinant protein detection functional annotation and comparative analysis of carbohydrate active enzymes functional and bioinformatic analysis of cloned maize c4 and arabidopsis c4 like ppdk regulatory protein — characterization of zebrafish udu mutant positional cloning and functional study of udu gene functional analysis of the cervicalfunctional analysis of intergenic a syntactic and semantic analysis of turkish nominal compounds a syntactic semantic and pragmatic analysis of conjunction structural and chemical analysis of materials subjectivity and sentiment analysis of arabic a survey subjectivity and sentiment analysis of modern standard arabic Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Chuong 2 nhận dạng rui ro BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ