cloning sequencing and restriction analysis of viral elutes from fta

... and pufferfish (torafugu and spotted green pufferfish) IL-10 sequences Pufferfish and carp IL-10 genes, clustered together and distant from IL-20 and IL24, as recently determined from analysis of ... control for the quantity and quality of cDNA Semiquantitative analysis of RT–PCR products Suspensions of Carp head kidney and liver cells were treated with 10 lgÆmL)1 LPS for 1, and h, individually, ... isolated and its genomic structure and expression analysis investigated This work will pave the way for further investigation of the biological function of this gene, and the probability of the...

Ngày tải lên: 20/02/2014, 02:21

... Interactions of recombinant CRP-1 and -2 Comparison of expression efficiencies of rCRP-1 and -2 Interactions of CRPs are enhanced in the presence of calcium, as well as during infection CRP-1 and -2 ... hemocytes and hemolymph of the horseshoe crabs 2.1 Primers used in the cloning of CrCRP-1 and 31 2.2 Proteins used for calibration of MALDI TOF MS/MS 51 3.1 Assessing the expression and purification ... tCRP-2 and tCRP-3, and each consists of several isoforms These exhibit differential binding affinity to various carbohydrate moieties, and have different hemolytic and haemagglutination profiles Of...

Ngày tải lên: 03/10/2015, 20:57

... evolved from a common ancestral gene, and the essence of most of the conserved amino acids has been further substantiated by site-directed mutagenesis of FHT [7,9] and by documentation of ligand ... in satsuma mandarin plants [30] Sequence analysis and mutagenesis The alignment of the polypeptide sequences of 2-oxoglutarate-dependent dioxygenases and related enzymes retrieved from data banks ... initially from Ruta species Flavonols originate from flavanones, i.e (2S)-naringenin, by the consecutive action of FHT and FLS (Fig 1), and both of these enzymes use molecular oxygen for catalysis and...

Ngày tải lên: 21/02/2014, 03:20

... http://www.virologyj.com/content/7/1/78 Page of Comparative sequence analysis of the B2L gene from this outbreak of orf was carried out, and the phylogenetic relationship of the virus with other ORFV sequences ... the leader of the project KZ carried out most of the studies and drafted the manuscript JH and JY amplified the complete B2L gene HZ, ZL and YS provided consultation and preparation of the final ... sequence analysis of major envelope protein gene (B2L) of Indian orf viruses isolated from sheep and goats Vet Microbiol 2006, 116:317-324 Inoshima Y, Morooka A, Sentsui H: Detection and diagnosis of...

Ngày tải lên: 12/08/2014, 04:20

... CB and EK participated in the planning of the project EK was the leader of the project ZL and CM collected the samples JA and RC, performed the PCR and phylogenetic analysis All authors read and ... the detection and partial sequencing of the B2L gene of a Brazilian ORFV isolate This is the first report on the phylogenetic analysis of ORFV in Brazil Case presentation In June of 2005, an exanthematic ... GenBank same sequences from fragment of the ORFV-MT05 and ORFV-NE1 major envelope protein gene (B2L) and comparison with Nucleotide Nucleotide sequence fragment of the ORFV-MT05 and ORFV-NE1 major...

Ngày tải lên: 12/08/2014, 04:21

... FEBS 1867 Analysis of upstream region of the Pokemon gene Y Yang et al decoy experiments using lg of the NEG-U decoy, lg of the NEG-D decoy, and a combination of lg each of the NEG-U and NEG-D ... different constructs in A549 and DU145 cells (C) The effects of lg of the NEG-U decoy, lg of the NEG-D decoy and a combination of lg of each decoy on the activity of F-560 The open ellipse indicates ... indicated above each lane (B) Activities of F-233 and MF-233 in A549 and DU145 cells (C) Activities of F-233 and varying amounts of the decoy oligonucleotides in A549 and DU145 cells WP-decoy indicates...

Ngày tải lên: 30/03/2014, 04:20

Ngày tải lên: 07/08/2014, 17:22

... collected from grass vegetation, from cattle and horse ranches and from different animals such as cattle, horse, dogs and rodents (data not shown) **Ticks were collected from rice fields and army ... buffer, 2.5 µl of 25 mM MgCl , µl of 2.5 mM deoxynucleoside triphosphate (dNTPs), 2.5 U of Taq-polymerase (Promega, USA), pmol of each primer, EEC and ECB (Genotech, Korea), and 200 ng of template ... Most of the ticks (896/1,288) investigated in this study originated from the rice fields and army training sites of Gyeonggi province Other ticks were collected from grass vegetation and cattle and...

Ngày tải lên: 07/08/2014, 18:21

... (Table 1) following the protocol of the manufacturer The cDNA was used as the template for PCR reactions in gene cloning and expression analysis Gene cloning and sequencing Initially, PCR was performed ... CCTTCGTCACCGAGACAAGC reagent following the protocol of the manufacturer, and resuspended in DEPC-treated water and stored at –80°C Synthesis of the cDNA first strand Materials and methods Shrimp About 40 appear ... sequence of Hsp90 was cloned using SSH and found the gene was up-regulated in the hepatopancreas during WSSV infection [24] In this report, we describe the cloning, sequencing, and expressions of the...

Ngày tải lên: 11/11/2016, 15:59

... result list of load cases, superposition files and influence lines 3.64 Version 8.38.03 • • • • Use of combination codes “SupOrX” and “SupAndX” for superposition files corrected New command “PLSCFAC” ... to choose between E- and Fformat of the written values Information about units added to the plot file of the action PlInfl, screen plot Results/ PlInfl and to the list file of the action DoList/Influence ... new program release! 1.2 Unit dependency of Import/Export of RM2000 Export and Import of RM2000 database is now UNIT dependent! In this case: • • Import of PARTIAL project, created by RM2000 Version...

Ngày tải lên: 06/09/2012, 15:18

... Disclaimer and Copyright Disclaimer Much time and effort have gone into the development and documentation of RM2000 and GP2000 The programs have been thoroughly tested and used The user accepts and ... the two load sets and the two loading cases (e.g.: L.C is a UDL of 10kN/m from Elem to Elem 20 and L.C is a Settlement of 0.001m at the beginning of element 1200.) Choose AddCon and insert the ‘Additional ... Point” from list and assign a name say “CP1” (define the connn points CP1 and CP2 at the centre of each beam soffit) Segment © TDV – Technische Datenverarbeitung Ges.m.b.H Select “Segment” and define...

Ngày tải lên: 06/09/2012, 15:55

... ‘editor’ button from the icons at the top of the RM2000 screen), write the sequence of commands and save it as ‘filename.tcl’ The summary and the syntax of the commands to be specified and used in ... Definition of loading and construction stages "RECALC Definition of calculation parameters and start of the calculation "RESULTS Viewing of results and creating of output files (plots and listings) ... displayed on the right hand side of the screen #NODE Definition of nodes and their attributes #ELEMENT Definition of elements and their attributes #TENDON Definition of tendons and their attributes...

Ngày tải lên: 06/09/2012, 15:55

... conditional breakfast They often have cereal or porridge, egg and bacon followed by toast and marmalade and coffee and tea or they may just have a toast and marmalade and coffee and tea *Elevenses - ... Definition of word meal - Field of word meal in English and in Vietnamese equivalents - Cultural and linguistic analysis of the English word meal Chapter III Cultural and linguistic analysis of Vietnamese ... People often drink a glass of mild and a sandwich 3.1.6 Parts of meal Basically, English meals and meal time are quite clear Even name of courses are also: starter, main course/ meat course and...

Ngày tải lên: 15/04/2013, 15:11

... relative intensity per lean of 0.5% of the total band intensity The presence or absence of bands in fingerprints of test systems A and B was used for the PCA Calculation of the phenol degradation ... labels a, b, and c are PCR-DGGE banding patterns of 16S rRNA gene in test systems A, B, and C, respectively; d, e, and f are PCR-DGGE banding patterns of C12O gene in test systems A, B, and C, respectively; ... collected from 300 mL of solution of test system C by filtration and then transferred into a 500 mL Erlenmeyer flask containing 300 mL of Hoagland solution with 10 mg/L phenol The concentration of phenol...

Ngày tải lên: 05/09/2013, 10:15

... making and energy storage Dr.Pohekar is a life member of Solar energy society of India and International society of multi-criteria decision making, and fellow of Institution of Engineers (India) and ... variation of HTF temperature and interface location at any instant can be easily obtained by integrating equations (5) and (6) with respect to X and Fo respectively and subsequent application of the ... the unit is in the form of latent heat as the sensible heating of the liquid PCM is neglected for the sake of simplifying the analysis Figure and Figure show the influence of particles as well as...

Ngày tải lên: 05/09/2013, 16:10

... using the Microsoft Excel spreadsheet and SPSS 17.0 software programs Results and discussion 3.1 Analysis of input-output energy use in canola production The amount of inputs and outputs for ... ratio of direct and indirect energy resources were nearly the same, while, the rates of renewable and non-renewable energies were fairly different from each other 3.2 Economical analysis of canola ... of sustainable, efficient and economic use of energy Energy use in small and large farms of canola production is not efficient and detrimental to the environment mainly due to excessive use of...

Ngày tải lên: 05/09/2013, 16:30

... results of all analyses and assume professional responsibility for the results It is assumed that the reader has an understanding of statics, mechanics of solids, and elementary structural analysis ... and are defined in terms of three numbers: modulus of elasticity E , Poisson’s ratio 1-2 STATIC AND DYNAMIC ANALYSIS ν and coefficient of thermal expansion α In addition, the unit weight w and ... edition of Three Dimensional Dynamic Analysis of Structures is included and updated in this book I am looking forward to additional comments and questions from the readers in order to expand the...

Ngày tải lên: 12/01/2014, 21:45

... Fig 10 Dynamic characteristics of the Internet—average degree, creation of nodes and links, and death of nodes and links; (a): mn and me denotes the number of nodes and links added since November, ... characteristics of the Internet; , Ko and DIKo are defined as the average diameter, K, and DIK of the original networks and df , Kf and DIKf denote the diameter, K, and DIK after 10% of the nodes ... acknowledge partial support from Ford Motor Co and useful comments from the anonymous referees and from Sunho Lim R EFERENCES [1] A Barab´ si and R Albert, “Emergence of scaling in random networks,” a...

Ngày tải lên: 18/02/2014, 01:20

... The domain labels are from the newswire genre and are adopted from (Abdul-Mageed, 2008) Polarity Lexicon: We manually created a lexicon of 3982 adjectives labeled with one of the following tags ... is templatic, and agglutinative and it is based on both derivational and inflectional features We explicitly model morphological features of person, state, gender, tense, aspect, and number We ... how and whither In Proceedings of the NAACL HLT 2010 First Workshop on Statistical Parsing of Morphologically-Rich Languages, Los Angeles, CA J Wiebe, R Bruce, and T O’Hara 1999 Development and...

Ngày tải lên: 20/02/2014, 05:20

... (Palmer et al., 2005) We conclude by offering a high level analysis of discoveries made and suggesting areas for continued analysis in the future Expanded analysis of these results is described in ... distributions of paths are much flatter (i.e a greater number and total relative frequency of path types) going from manual to automatic parses and from parses of verbatim to parses of reconstructed ... often for downstream processes such as information extraction and question answering Reliably identifying and assigning these roles to grammatical text is an active area of research (Gildea and...

Ngày tải lên: 20/02/2014, 07:20