Cloning and expression of the plasmodium falciparum metacaspase gene PfMCA1

Cloning and expression of the plasmodium falciparum metacaspase gene PfMCA1

Cloning and expression of the plasmodium falciparum metacaspase gene PfMCA1

... Optimization of the PfMCA1 gene sequence for yeast expression The original PfMCA1 gene sequence, the optimized PfMCA1 gene, and the PfMCA1 amino acid sequence are shown in black, green and blue respectively ... attached at the C-terminus of the cloned gene Cloning was achieved by having the NheI restriction site and BamHI restriction site at the 5’...

Ngày tải lên: 03/10/2015, 20:57

119 233 0
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot

Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot

... activity of the purified chicken liver ecto-ATPDase is  30% of the MgATPase activity at a divalent ion-ATP concentration of mM at pH 7.4 On the other hand, the CaADPase activity is  80% of the ... activated by the same detergents and are extracted from the membranes by high concentrations of NP-40 [7,23] (and this study) This study shows unambiguously that the...

Ngày tải lên: 22/02/2014, 04:20

10 694 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

... genes involved in host defence against bacterial infection in rainbow trout (Oncorhynchus mykiss) , the gene -expression profile of bacterial-challenged rainbow trout was surveyed by means of suppression ... player in the cytokine network and the host immune response to infection in fish Experimental procedures Cell lines and cell culture Four rainbow trout...

Ngày tải lên: 07/03/2014, 16:20

12 512 0
Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps

Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps

... PCR positivity by the broad-range PCR amplification system PCR was positive in 20 of the 27 (74.10%) patients indicating the presence of bacterial 16S rDNA within the synovial samples Of note, PCR ... between the presence of a particular bacterial DNA and clinical symptoms Discussion In the present study we used broad-range PCR amplification, cloning, a...

Ngày tải lên: 09/08/2014, 14:22

11 462 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTG...

Ngày tải lên: 23/03/2014, 21:20

5 436 0
Báo cáo khóa học: Cloning and expression of murine enzymes involved in the salvage pathway of GDP-L-fucose ppt

Báo cáo khóa học: Cloning and expression of murine enzymes involved in the salvage pathway of GDP-L-fucose ppt

... of the expression of the enzymes involved in the salvage pathway of GDP-L-fucose indicates that not only the de novo pathway alone, but also the salvage pathway could have an essential role in ... and the corresponding gene has been cloned from human [23] In the present study we have cloned the murine genes coding for the enzymes involved...

Ngày tải lên: 30/03/2014, 13:20

9 437 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... product of the second round of PCR was cloned and the 1066 bp sequence encoding 125 amino acids of the A-chain, the 19 amino acids linker, and 216 amino acids of the B-chain of the ml gene was obtained ... (Met153 of the ML1p and ML2p B-chains and Met156 of the ML3p B-chain corresponding to the ricin B-chain Leu152; and Met234 of the ML1p and...

Ngày tải lên: 07/03/2014, 15:20

11 611 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

... localization of the enzymes involved in cholesterol biosynthesis and with the puri®cation of the bovine protein from the ER Determination of D14-SR activity To demonstrate that the cloned bovine liver ... presence of signature patterns conserved from yeast D14-SR (ERG24 gene) and sterol D24(28)-reductase (ERG4 gene), as well as the degree of similarity with human LBR...

Ngày tải lên: 08/03/2014, 16:20

8 494 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

... lack of a second heparin-binding domain [3,4,13,26] Comparative analysis of the Xenopus and mammalian APLP2 proteins Comparing the amino acid sequences of the two X -APLP2 proteins with the human, ... domains within a protein, we here identify the first nonmammalian APLP2 protein in the amphibian Xenopus laevis and present a phylogenetic analysis...

Ngày tải lên: 16/03/2014, 16:20

7 406 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

... Full-length cDNA for expression was cloned by another RT-PCR with primers fullMJEforMQ (GCATGCAGGGTGATAAAAA TCACTTTGTA) and fullMJErev (AAGGATCCATAA TATTTTTGCGAAATC), adding restriction sites for SphI and ... of tomato Proc Natl Acad Sci USA 99, 6416–6421 17 Meyer, R., Rautenbach, G.F & Dubery, I .A (2003) Identification and quantification of methyl jasmonate in leaf volati...

Ngày tải lên: 16/03/2014, 18:20

8 458 1
Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf

Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf

... results, the expression vector pLac1-B was selected to characterize the recombinant laccase from A niger Immunodetection of the recombinant laccase and expression of the corresponding gene in A niger ... wild-type laccase from P cinnabarinus Immunodetection of the laccase was performed using antibodies raised against the P cinnabarinus laccase...

Ngày tải lên: 17/03/2014, 11:20

8 496 0
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx

Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx

... isolated and sequenced two full-length cDNAs from D purpurea leaves that encode DpAR1 and DpAR2, two new members of the AKR superfamily; specifically, the amino-acid sequences of DpARs show relatively ... the cloning and expression of two AKR genes from D purpurea Both proteins reduce the ketone group of steroid structures but they are not active on the D4-dou...

Ngày tải lên: 18/03/2014, 01:20

9 570 0
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

... expression of L schmitti CHH gene The size and expression of the CHH mRNA in different tissues were determined by northern blot analysis of total RNA isolated from eyestalk, muscle and stomach ... interference RNA in vivo, for example, the length of target mRNA, the length and concentration of dsRNA, the region of homology between the dsRNA and t...

Ngày tải lên: 23/03/2014, 10:20

9 486 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...

Ngày tải lên: 23/03/2014, 13:20

11 476 0
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

... human and a murine NICN1 cDNA clone from the IMAGE collection and determined the complete sequences of these cDNAs The comparative analysis of the human, canine, and murine NICN1 cDNA revealed a ... CACCAGgtcagctgggcctca 423 418 bp (exon 3, 11 4 bp) … CCAAAGgcaagtgactttgca 4 01 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca 3 71 bp (exon 5, 10 5 bp) 600 … TTCGACgtgag...

Ngày tải lên: 23/03/2014, 21:20

6 450 0
w