Characterization of aptamer protein interactions using optical and acoustic biosensors
Characterization of aptamer protein interactions using optical and acoustic biosensors
... primary aptamers, 2) the effects of DNA spacer in aptamers on sandwich complex formation and on detection sensitivity, and 3) the possibility of forming sandwich complex with two aptamers of the ... study of DNA secondary structure and also the aptamer- protein interactions on surface, which in consequence will be useful in the development of DNA aptamer- based thrombin...
Ngày tải lên: 03/10/2015, 20:32
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf
... (2008) A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins FEBS J ... both luminal proteins Generally, PDI family proteins play important roles in folding and quality control of nascent polypeptides [25] In soybean cotyledon, lar...
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: C-terminal, endoplasmic reticulum-lumenal domain of prosurfactant protein C – structural features and membrane interactions ppt
... –6 –8 –1 0 210 220 230 240 λ (nm) 250 260 C C –2 –4 θ –6 –8 –1 0 Urea (M) 10 Fig Effects of urea on CTC secondary structure CD spectra of CTC in 0–8 M urea increasing by M steps, as indicated by ... maxima at 59 C and 6 6–6 7 C (Fig 8B) The first, second and third heat capacity curves of membrane- bound CTC overlapped Intrinsic fluorescence experiments...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx
... of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered on the top ... indicating that Rv1399c is composed of 22% of a- helices, 25% of b-strand and 39% of random coil The catalytic triad is located at the bottom of a s...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Structural and mutational analyses of protein–protein interactions between transthyretin and retinol-binding protein doc
... b-strands H and F To form the tetramer, two dimers associate back to back, mainly through hydrophobic contacts between residues of the loops formed by b-strands A and B and b-strands G and H One of ... crucial for protein protein interactions, causes the lack of recognition between RBP and TTR and an altered plasma transport of RBP by TTR [37,38] It might be hypot...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx
... 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ 5¢-GCACCTCCTGATCTTCCCCCTTCAATCC-3¢ ... 11222–11228 11 Sun Y, Mansour M, Crack JA, Gass GL & MacRae TH (2004) Oligomerization, chaperone activity, and nuclear localization of p26, a small heat...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: "Phylogenetic characterization of genes encoding for glycoprotein 5 and membrane protein of PRRSV isolate HH08" docx
... between NA and EU types; for example, the lengths of ORFs and of most EU-type PRRSVs are 606 nt and 52 2 nt, respectively The lengths of both ORFs of most NA-types of PRRSVs are 603 and 52 5 nt, respectively ... AY737282 DQ 355 796 GQ128443 AY 450 301 EU480 753 EU480 754 EU880443 DQ246 451 EF517962 EF0 759 45 AY74 759 5 FJ947000 FJ919342 DQ379479 AY513611 FJ361891 FJ8 9...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo y học: "Cloning, expression and characterization of gE protein of Duck plague virus" doc
... usually consist of a tetrapeptide bearing the sequence YXXØ (Y is tyrosine, X is any amino acid, and Ø represents any hydrophobic residue) [36,37] The DPV gE protein contained YGSY and YNSL in ... production of polyclonal antibody Intervirology 2009, 52:141-151 12 Liu FY, Ma B, Zhao Y, Zhang Y, Wu YH, Liu XM, Wang JW: Characterization of the gene encoding glycoprotein C of...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Improving the prediction of yeast protein function using weighted protein-protein interactions" pps
... locates the neighbour proteins and predicts their assigned functions and the frequency of these functions; the functions are arranged in descending order according to their frequencies The first k functions ... for the presence of a certain function for a protein of interest: (1) number of proteins having this function; (2) number of protein pairs (interacting) havi...
Ngày tải lên: 13/08/2014, 16:20
Biochemical identification and functional characterization of microrna target interactions in growth control and cancer transformation
... characterizations of miRNA -target interactions involved in growth control and cancer transformation I used biochemical immunoprecipitation against Drosophila Ago1 (Ago1-IP) to isolate and purify Ago1/miRNA/mRNA ... protein (green) and GW182 (blue) GW182 proteins contain an N-terminal AGO-binding domain, which provides multiple binding sites for Argonaute proteins and...
Ngày tải lên: 09/09/2015, 10:17
The development of acidic protein aptamers using capillary electrophoresis methods and their use in surface plasmon resonance
... also contains the ligand The nanoparticle binds to the analyte which causes an increase in mass upon binding to the ligand on the surface of the sensor and causing a boost in signal Another mass ... globulin proteins by comparing the peak height of the DNA peaks71 24 1.5 Objectives and Scope of the dissertation The focus of this thesis will be on the d...
Ngày tải lên: 10/09/2015, 09:22
Structural and functional characterization of signaling protein complexes
... List of Tables Page Table 1.1 List of common and important PTMs 23 Table 1.2 IQ motifs of established and potential CaM target proteins 37 Table 2.1 Data collection and refinement statistics of ... domains that mediate protein- protein, protein- lipid, and protein- DNA interactions (Fig 1.4) The most common protein- protein interaction domains in NRTKs are the Src homology...
Ngày tải lên: 11/09/2015, 09:11
Proteomic characterization of novel protein protein interactions for understanding functions of gene products
... tool for the identification and isolation of potential interacting protein partners for your protein of interest The knowledge requirement for your protein of interest is only very minimal If a protein ... time the corresponding gene is cloned Last but not least, modification of this system has allowed for studies of protein- DNA and protein- RNA interactions K...
Ngày tải lên: 12/09/2015, 08:19
Isolation and characterization of anticoagulant protein from the venom of hemachatus haemachatus (african ringhals cobra
... synergistically acting anticoagulant three-finger proteins, hemextin A and hemextin B were purified from the venom of the elapid Hemachatus haemachatus (African Ringhals cobra) using standard chromatographic ... characterization of the complex using gel-filtration chromatography 87 Chapter Three Mechanism of Anticoagulant Activity vi Identification of the...
Ngày tải lên: 14/09/2015, 13:36