Signaling pathway inhibitor library screening reveals b catenin TCF4 as a novel telomerase regulator in cancer cell lines

... (ChIP) assays Results Inhibitors screening < /b> Verification of screening < /b> platform using STAT III and IV inhibitors Wnt pathway < /b> inhibitor < /b> library < /b> screening < /b> EGFR pathway < /b> inhibitors library < /b> screening < /b> JAK/STAT ... Telomerase related screen Wnt signaling < /b> pathway < /b> Canonical Wnt pathway < /b> Non-canonical Wnt pathway < /b>...

Ngày tải lên: 02/10/2015, 17:14

... UCSC annotated sequences (UCSC Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other ... pre-miR-30d, RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacture...

Ngày tải lên: 09/08/2014, 23:20

... experiments and participated in analysis of data CA performed the statistical analysis and the clinical associations AS participated in the analysis and interpretation of data and in the revision of the ... Capoano R, Profumo E, Siracusano A, Salvati B, Rigano R, et al.: Screening of a HUAEC cDNA library identifies actin as a candidate autoantigen asso...

Ngày tải lên: 09/08/2014, 06:23

... GCCCGCTTTGCCCCTAACA 359 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 GCGCCCGCTTCATCACTG 101 TTGCCGGGGAAGGTCACG ... inhibitors and correlate this with pro-collagenase activation and aggrecan and collagen release Materials and methods Cartilage degradation assay Bovine nasal cartilag...

Ngày tải lên: 09/08/2014, 08:22

... A, Gray JW: A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes Cancer Cell 2006, 10:515-527 Genome Biology 2009, 10:R31 http://genomebiology.com/2009/10/3/R31 ... identification of key cell signaling events in the context of cancer Materials and methods Cell lines The complete panel contains 51 breast cancer cel...

Ngày tải lên: 14/08/2014, 21:20

... clinical trials in melanoma patients Two clinical trials of dasatinib in melanoma are currently underway, including a phase I/II study of dasatinib in combination with dacarbazine http://www.clinicaltri ... with dasatinib Discussion We have evaluated the effects of dasatinib, a multi-targeted tyrosine kinase inhibitor, in human melanoma cell lines [6] In a...

Ngày tải lên: 18/06/2014, 15:20

... viability is due to the induction of apoptosis, we measured caspase activity in ARRY-520- treated Type II EOC cells Following ARRY-520 treatment, a significant increase in the activity of caspases- ... not for citation purposes) Journal of Translational Medicine 2009, 7:63 Indianapolis, IN) following the manufacturer's instructions Luciferase activity was measured using the Luci...

Ngày tải lên: 18/06/2014, 15:20

... independently analyzed by two investigators The staining score was calculated from the staining intensity and percentage of positive staining cells The staining intensity was scored as (very weak), (weak), ... http://www.translational-medicine.com/content/9/1/64 Page of 10 Figure Analysis of the expression and localization of phosphorylated c-MET in RMS tissue samples Represen...

Ngày tải lên: 18/06/2014, 19:20

... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell < /b> line-based platforms to < /b> evaluate the < /b> therapeutic efficacy of < /b> candidate anticancer agents Nat Rev Cancer < /b> ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora < /b> kinase inhibitors: a < /b> new class of < /b> targeted drugs in < /b> cancer < /b> Clin Lung...

Ngày tải lên: 18/06/2014, 22:20

... independently analyzed by two investigators The staining score was calculated from the staining intensity and percentage of positive staining cells The staining intensity was scored as (very weak), (weak), ... http://www.translational-medicine.com/content/9/1/64 Page of 10 Figure Analysis of the expression and localization of phosphorylated c-MET in RMS tissue samples Represen...

Ngày tải lên: 20/06/2014, 03:20

... inhibitors Conveniently, it is < /b> standard clinical practice to < /b> perform karyotyping on hematological < /b> cancer < /b> cells and chromosome < /b> number < /b> can serve as a < /b> resistance marker for patient response < /b> to < /b> GSK1070916 ... percentage of < /b> polyploidy in < /b> cell < /b> subpopulations For instance, the < /b> karyotype data for the < /b> T...

Ngày tải lên: 20/06/2014, 04:20

... in human alveolar macFigure rophages (AM) LMP-420 inhibits replication of M Tb in human alveolar macrophages (AM) AM were collected by bronchial-alveolar lavage from healthy volunteers and infected ... release of pro-inflammatory cytokines/chemokines, such as TNF and MCP-1, may be beneficial in inhibiting the replication of HIV-1, M Tb, or both The potential advantage...

Ngày tải lên: 10/08/2014, 05:20

... 8-aa insertion < /b> between aa123 and aa124 in < /b> S < /b> gene < /b> [14], aa insertion/< /b> deletion in < /b> HBsAg had been reported in < /b> following studies, they included 2-aa insertion < /b> between aa122 and aa123 [15,16], 3-aa insertion < /b> ... 5-aa insertion < /b> between aa128 and aa129 [22], which located into HBs3(also in < /b> first loop of < /b> α determinant...

Ngày tải lên: 12/08/2014, 04:20

... kinetics in the expression of gene subsets induced by TNF-α in UM-SCC cell lines The responsive kinetics of many of the novel NF-κB target genes are either slowly induced, or induced and sustained ... Bradford C, Carey T, et al.: Genetic and expression profiles of squamous cell carcinoma of the head and neck correlate with cisplatin sensitivity and...

Ngày tải lên: 14/08/2014, 08:20

... of the b-catenin signaling pathway in a-defensininduced increases in the proliferation and collagen synthesis of lung fibroblasts using quercetin Quercetin, which inhibits the Wnt ⁄ b-catenin signaling ... a-defensin1 and a-defensin-2 stimulate the proliferation and collagen synthesis of lung fibroblasts Our novel findings on the role of the b-catenin...

Ngày tải lên: 18/02/2014, 06:20