atpδ reveals a novel mitochondria to nucleus signaling pathway

... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... CAGGGTTTGGCCGATACTTA Primer Alias Sequence 1247 RNR3R CTTCTTTTTGGGCCAATTCA 1280 BNA2 5' CTCGACGCTGATTGGCTAA 1248 YKL161CF TGGCCGAACTACTTGGTAGG 1281 BNA2 3' 1249 YKL161CR GCAATGTTTCCTCAGGTGGT GTAACCAGTACGAAAAAAGATA...

Ngày tải lên: 14/08/2014, 21:20

... incubation assays using 30 lg of purified enzyme eluate For quantification, 200 lL of an acetonic solution of a- tocopherole acetate (1 mgÆmL)1) was added as internal standard to each assay prior to ... Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 189–194 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu 15 17 18 ... Journal compilation ª 2008 FEBS No claim to original German government works 743 A novel route for geranial formation A Ilg et al to the peak area of the internal standard, which was quantified at...

Ngày tải lên: 07/03/2014, 03:20

... chain was represented as a concept vector in concept vector space, and the overall text vector was made up of those concept vectors The semantic importance of concepts and words was normalized according ... we can not deal all the concept of a document, we discriminate representative chains from lexical chains Representative chains are chains delegated to represent a representative concept of a document ... information quantity of a word Wj |T is illustrated below Denition (Information Ratio, ) Information ratio is the ratio of the information quantity of a comparative target to the information quantity...

Ngày tải lên: 23/03/2014, 19:20

... but rather by the perceived threat it poses to the intactness of the self, i.e the impact and meaning a disease has for a patient In addition, personality factors are assumed to play an important ... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self-report measures were calculated Differences between male and female participants and between ... significantly from one another Results Means and standard deviations for all variables are displayed in Table Type of diabetes Compared to people with type diabetes, people with type diabetes had a...

Ngày tải lên: 18/06/2014, 19:20

... EF drafted the manuscript and participated in the design, data collection, and data analysis KB helped draft the manuscript and participated in the design and data analysis and interpretation ... treatment Statistical analysis Descriptive statistics were used to summarize the demographic and clinical characteristics of the study population at baseline The analysis of the OPSAT-Q data focused ... conceptually related scales are substantially correlated with each other (r > 0.40) Reliability Internal consistency reliability (Cronbach's alpha) was calculated for each of the OPSAT-Q scales...

Ngày tải lên: 20/06/2014, 15:20

... but rather by the perceived threat it poses to the intactness of the self, i.e the impact and meaning a disease has for a patient In addition, personality factors are assumed to play an important ... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self-report measures were calculated Differences between male and female participants and between ... significantly from one another Results Means and standard deviations for all variables are displayed in Table Type of diabetes Compared to people with type diabetes, people with type diabetes had a...

Ngày tải lên: 20/06/2014, 16:20

... the data link layer can provide a transmission range of up to 1,000 m for a channel VANET applications can use a longer range, R, for the control channel so that a cluster-head can communicate ... “First Declaration Wins rule”, which is basically a node that first claims to be a clusterhead remains as a cluster-head and rules the rest of nodes in its clustered area According to the authors’ ... d stable neighbors can have large values, it is necessary to use the normalization technique to avoid having this parameter dominate the results of the calculation The normalized mean distance,...

Ngày tải lên: 20/06/2014, 20:20

... the total number of normal data The false negative rate is defined as the total number of attack data that were incorrectly classified as normal traffic divided by the total number of attack data 7.1 ... learning dataset with above-described dataset This dataset had 100,000 normal packets and 1,000 to 1,500 abnormal packets for training and evaluating each In the case of unsupervised learning algorithms ... because each data value is too small or too few points are assigned to a cluster center due to a bad initialization of the means In case of internet traffic, this problem can also occur because each...

Ngày tải lên: 21/06/2014, 05:20

... that the tolerance mask is not always touched by the magnitude response In some regions the magnitude response ranges far below the allowed attenuation, which can be traced back to the fact that ... delay yields a smoothing effect In the stopband the group delay is apparently not minimized at all Therefore the stopband can be regarded as a “do not care” region thus increasing the available degrees ... yield a convex optimization problem 3.2.1 Passband Narrow-band low-pass filters usually not exhibit a distinctive passband In order to obtain a narrowband low-pass filters it is sufficient to ask for...

Ngày tải lên: 21/06/2014, 19:20

... as-grown p–i NWs The average length of our as-grown p–i NWs amounted to 300 nm and diameter to 125 nm (see Fig 1a, b) As gold can act as an effective phosphorus ion stopper because of its heavy ... mechanism is dominating A value close to for the ideality factor indicates that recombination across the p–n junction through the surface states is dominant in the carrier transport mechanism ... different dopants [6] A two-step implantation of phosphorus ions at room temperature was used to obtain a rectangular dopant profile The implantation energies were 45 and 25 keV corresponding to doses...

Ngày tải lên: 22/06/2014, 00:20

... , Ttotal − Tmin RA = Alimit , Atotal RS = Slimit Stotal (8) The totalised values for area Atotal , code size Stotal , and execution time Ttotal are simply built by the sum of the maximum gate ... l n k g m ALAP stalap (b) Figure 9: Two different start times for process (b) according to ASAP and ALAP schedule sequential device It has to be stated that Tmin and Ttotal are lower and upper ... processes onto an identical architecture (Figure 1) starting from a directed acyclic graph (DAG) The objective function incorporates several constraints on the available silicon area (hardware capacity),...

Ngày tải lên: 22/06/2014, 06:20

... liver parenchyma Br J Surg 1999, 86:784-788 Kokudo N, Tada K, Seki M, Ohta H, Azekura K, Ueno M, Ohta K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: ... Preoperative portal vein embolization for extension of hepatectomy indications Hepatology 1996, 24:1386-1391 Imamura H, Shimada R, Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: ... M, Miyagawa S, Kakazu T: Radical operation after portal embolization for tumor of hilar bile duct J Am Coll Surg 1994, 178:480-486 Kawasaki S, Makuuchi M, Kakazu T, Miyagawa S, Takayama T, Kosuge...

Ngày tải lên: 09/08/2014, 04:21

... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular cartilage and synovial fluids of patients with rheumatoid arthritis Clin Rheumatol ... MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and OA [2-4]...

Ngày tải lên: 09/08/2014, 08:22

... Ws-2 are archived at TAIR and available as a track on the Arabidopsis genome hosted at TAIR [SpeciesVariant:393] [41] SNP validation To validate the SNPs between ebi-1 and Ws-2, we used a simple ... Hordeum vulgare subsp vulgare (AAY17586, PRR), Arabidopsis thaliana (AAY62604, PRR3), Triticum aestivum (ABL09464, PRR), Oryza sativa Indica (BAD38858, PRR 37), Oryza sativa Indica (BAD38859, PRR73), ... constant dark data set A second gene, AtNFXL-2 (At5g05660), a zinc finger transcription factor, was not rhythmic in constant light but had a 0.91 correlation with a sine wave in constant dark and...

Ngày tải lên: 09/08/2014, 22:24

... vitro assays, data interpretation, statistical analysis and compilation of the manuscript DAS and JPH assisted with the Luminex assay use and data collection, then read and edited the manuscript after ... 1066 Chang H, Israel H: Analysis of inflammatory mediators in temporomandibular joint synovial fluid lavage samples of symptomatic patients and asymptomatic controls J Oral Maxillofac Surg 2005, ... effects of pentobarbital, fentanyl-droperidol, ketamine-xylazine and ketamine-diazepam on arterial blood pH, blood gases, mean arterial blood pressure and heart rate in adult male rats Lab Anim Sci...

Ngày tải lên: 11/08/2014, 08:21

... Carrabba M, Scita G, Santantonio C, Pilla L, Tragni G, Lombardo C, Arienti F, Marchiano A, Queirolo P, Bertolini F, Cova A, Lamaj E, Ascani L, Camerini R, Corsi M, Cascinelli N, Lewis JJ, Srivastava ... Hsp70PCs as bait In each case, approximately 400–1000 phages were retained after four rounds of panning A total of twenty four phage clones were selected at random for further analysis DNA was isolated ... production in a similar way to that of LPS [46-49] These findings are in agreement with previous data showing that Hsp70 can enhance the ability of APCs for antigen uptake [50,51] and can activate T...

Ngày tải lên: 11/08/2014, 10:23

... tumor and its matched normal sample across all patients Table 2: Glioblastoma drug targets Drug name Target Pathway Accutane RARA Map kinase inactivation of smrt co-repressor CCNU STMN4 Signaling ... mediated by p38-gamma and p38-delta pathway Celebrex COX2 Signaling mediated by p38-alpha and p38-beta pathway Cis Retinoic Acid RARA Map kinase inactivation of smrt co-repressor Sorafenib RAF1 ... each pathway in the database) to each sample in every dataset Network information has been obtained from The National Cancer Institute's Pathway Interaction Database (PID) [12] We then iterated...

Ngày tải lên: 11/08/2014, 12:21

... serosanguinous fluid was aspirated (Figure 3) Dramatic pain relief was noted after aspiration An elastic stocking was applied to his left calf area after aspiration and follow-up two weeks later ... muscle Am J Sports Med 1977, 5:191-193 Takebayashi S, Takasawa H, Banzai Y, Miki H, Sasaki R, Itoh Y, Matsubara S: Sonographic findings in muscle strain injury: clinical and MR imaging correlation ... machine and S12 5–12 MHz real-time linear–array transducer (Philips Medical Systems) were used to examine the patient After careful examination, bilateral symmetrical sonographic findings of the calf...

Ngày tải lên: 11/08/2014, 17:21

... necessary for B-cell activation and contributes to a prolongation of Bcell antigen receptor signaling Thus, CR2 plays an important role in B-cell activation and combines the innate and adaptive arms ... regulated This regulation is mediated by proteins such as cell surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that ... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens...

Ngày tải lên: 12/08/2014, 04:21