Latinas and abortion, the role of acculturation, religion, reproductive history and familism
... found that 28.1% of foreign-born Latinas had a history of abortion, 80% of U.S born Latinas had a history of abortion, and 71.4% of U.S born non -Latinas had a history of abortion The researchers ... UNIVERSITY OF MIAMI A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy LATINAS AND ABORTION:...
Ngày tải lên: 01/10/2015, 17:30
... illustrates the main structural, theoretical and incentive-related policy implications of circuit theory of finance Section I.2 discusses the special role of the financial system as the core of the circuit ... profitability is declining The internalization of information within the same institution may thus enhance intra -circuit and inter -circuit st...
Ngày tải lên: 24/10/2012, 09:33
... about the facts of Vietnam freight forwarding industry and the Association s importance to the industry, especially in today’s economic integration process Therefore, I chose the topic Facts of Vietnam ... Association (VIFFAS) and then emphasize on the role of the Association (VIFFAS) to Vietnam freight forwarding industry...
Ngày tải lên: 27/10/2012, 16:42
Báo cáo y học: "Human toxoplasmosis and the role of veterinary clinicians"
... aged This is particularly true with regards to T gondii, where the consequences of infection can be very severe, while the risk of living with one’s beloved cat is practically nill References Angulo ... Shin DW, Lee TY, et al Seroprevalence of Toxoplasma gondii infection and risk factors associated with seropositivity of pregnant women in Korea J Parasitol 2008; 94: 963-965 Gran...
Ngày tải lên: 03/11/2012, 11:06
The role of language in adult education and poverty reduction in Botswan
... program in Botswana maintains the hegemony and the gap between the poor and the rich, the major and minority groups In order to redress poverty the adult education program needs to be aware of the social ... vital in fighting poverty The adult education program can thus harness the local languages and indigenous knowledge of the minority and...
Ngày tải lên: 05/11/2012, 16:27
153 The role of marketing activities to bankcard and actual state of Ngân hàng nông nghiệp và phát triển nông thôn (AgriBank) cards
... continuously made an effort to diversify the variety of services to meet and satisfy better customers’ needs and demands 2.2.3 The role of marketing to Agribank cards Tasks of Marketing Department was ... work and plans of department to the Director, make plans and assign tasks to the staff to complete objects of Department and the branch - M...
Ngày tải lên: 03/04/2013, 12:13
494 The role of marketing activities to bankcard and actual state of Ngân hàng nông nghiệp và phát triển nông thôn (AgriBank) cards
... triển thời gian chủng loại hàng hoá thường mở rộng Công ty phát triển chủng loại hàng hoá hai cách: phát triển bổ sung Quyết định phát triển chủng loại hàng hoá Phát triển hướng xuống Nhiều ... tập Tài khoản số: 43101-000992 Chi nhánh ngân hàng Nông nghiệp phát triển nông thôn Thăng Long Mã số thuế: 0100777671-1 Chức Công ty thiết bị phát tri...
Ngày tải lên: 08/04/2013, 17:01
Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx
... failure Plants and failed to take on the knowledge transfer, whereas the other four succeeded Transfer of Knowledge and the Role of Motivation CASE STUDY Plant is a small plant, based in northern ... popularity of knowledge transfer and similar methods of learning Cases such as SCA Packaging highlight the need to understand better the role of mot...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu Báo cáo khoa học: Regulation of DNA fragmentation: the role of caspases and phosphorylation doc
... signal on and off Caspase activation is under the direct control of kinases and phosphatases, and the indirect control of phosphorylation through the regulation of other apoptotic proteins Furthermore, ... activity of the MAPK family mediates the downregulation of various phosphorylations, such as those of mitochondrial Phosphorylation and caspases in DN...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... Atlanta, GA 30333 SUGGESTED CITATION Centers for Disease Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by ... Committee and the Advisory Committee for Elimination of Tuberculosis published a joint statement on the use of BCG va...
Ngày tải lên: 15/02/2014, 13:20
Tài liệu Egypt''''s Water Warriors : Water Pollution in Egypt and the Role of NGOs in Reaching Integrated Management ppt
... of groundwater in Saint Katherine, South Sinai, Egypt and exploring the diversity, occurrence and distribution of fungal taxa in groundwater in South Sainai, samples of groundwater from 27 sites ... initiative in order to get the school student involved in protection of the Egyptian environment in general and Egypt' s waters in particular On the 3rd of...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Research " THE ROLE OF EDUCATION IN ECONOMIC TRANSITION AND POLITICAL TRANSFORMATION IN POST-COMMUNIST COUNTRIES " ppt
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Research " THE ROLE OF IMPORT SUBSITITUTION AND EXPORT ORIENTATION STRATEGIES ON THAILAND''''ECONOMIC GROWTH " ppt
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx
... union and separation of complementary strands during renaturation and strand exchange, respectively, and thereby assesses the recombinase activity of OsDmc1, as has been shown for other recombinase ... ATP- c-S in some assays as mentioned in figure legends Effect of deproteinazation on strand exchange activity To check whether the strand exchange activity...
Ngày tải lên: 19/02/2014, 07:20