Oxidative stress regulates DTNBPI dysbindin 1 expression and degradation via a pest sequence in it s c terminus
... HindIII sites including the predicted core promoter of dysbindin- 1A was isolated using a forward CAGTCTCGAGAGGACTGGGGATGTCACTCA-3’) primer and reverse (5’primer (5’- GTACAAGCTTAACCCAGCCTTCTCCAAG-3’) ... PEST sequence on Dysbindin- 1 expression in vitro PEST sequence under oxidative stress was investigated using SH-SY5Y human neuroblastoma cells that stably overexpres...
Ngày tải lên: 01/10/2015, 17:27
... glycoxidation product N(epsilon)-(carboxymethyl)lysine in human tissues in diabetes and aging J Clin Invest 1997, 99:457-468 Le Maitre CL, Freemont AJ, Hoyland JA: The role of interleukin-1 in ... Freemont AJ: Interleukin-1 receptor antagonist delivered directly and by gene therapy inhibits matrix degradation in the intact degenerate human intervertebral disc: an in situ...
Ngày tải lên: 09/08/2014, 10:23
... Figure proteins in vaccinia virus infected human and heat shock RT-PCR1analysis of the heat shock factor blood macrophages RT-PCR analysis of the heat shock factor and heat shock proteins in vaccinia ... of interleukin 12 and interleukin 10 expression in vaccinia virus- infected human monocytes and U-937 cell line Cytokine 2000, 12 :900-...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo khoa học: " Systemic hypothermia increases PAI-1 expression and accelerates microvascular thrombus formation in endotoxemic mice" ppsx
... Systemic hypothermia superimposed on endotoxemic challenge further increases microvascular thrombus formation in vivo This involves an increase in circulating PAI-1 expression rather than being ... resulted in a marked increase in the expression of P-selectin and PAI-1 within the microvascular endothelium In endotoxemic animals endothelial PAI-1 expres...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo y học: "Activation of HIV-1 expression and replication by cGMP dependent protein kinase type 1-β (PKG1β)" docx
... time of infection with cGMP agonists -8-pCPTcGMP and Sp-8-pCPT -cGMP or cGMP antagonist (Rp-8pCPT-cGMPs) Culture supernatants were collected every third day and assayed for virus production by RT ... resulted in dose dependent increase in viral protein expression Expression of FLAG-tagged transfected PKG1β (top panel) and HIV-1 viral proteins are shown by Western bl...
Ngày tải lên: 13/08/2014, 05:22
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... nucleotide exchange factor with activity towards Ras Results HEK293 cells express the guanine nucleotide exchange factor Ras-GRF1 The guanine nucleotide exchange factor Ras-GRF1 is mainly expressed in ... physiological role of the guanine nucleotide exchange activity of the truncated forms is not known as they are missing the Ca2+ ⁄ CaM-bindin...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx
... relatively low amount of cystatin F produced by U937 cells reported earlier [5] is an underestimate of the real production of cystatin F in U937 cells The high portion of intracellular cystatin F led ... production of cystatin F compared to the ubiquitous inhibitor, cystatin C, we measured the cystatin contents in cell lysates and culture media o...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx
... exclusively of AATs from prokaryotes, including AATs from proto- Identification of a new aspartate aminotransferase zoa, archaebacteria and bacteria Interestingly, plants also have Ib subgroup-prokaryote-type ... mean ± SD of three determinations B subtilis B3 AATB3 Substrates L -aspartate L-glutamate a- ketoglutarate Oxaloacetate Fig Characterization of the purifi...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Endogenous mono-ADP-ribosylation mediates smooth muscle cell proliferation and migration via protein kinase N-dependent induction of c-fos expression potx
... MAP kinase, Rho mediates growth factor-dependent activation of c-fos via the serum response factor (SRF) [30] Protein kinase C-related kinase (PRK1), also termed protein kinase N (PKN), and PRK2 ... the proliferation of human and rat vascular smooth- muscle cells Biochem J 283, 403–408 Saward, L & Zahradka, P (1997) Coronary artery smooth muscle in culture:...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Bile acids increase hepatitis B virus gene expression and inhibit interferon-a activity pot
... regulation by bile < /b> acids < /b> in human hepatoma cells Cholic acid and chenodeoxycholic acid (CDCA) are two major primary bile < /b> acids < /b> detected in human bile < /b> [19– 21] The effects of bile < /b> acids < /b> on HBV gene expression ... Authors Journal compilation ª 2010 FEBS H Y Kim et al Bile < /b> acid metabolism and HBV gene expression Fig The effect o...
Ngày tải lên: 22/03/2014, 21:21
Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx
... sugars produced Michaelis constant (Km) and maximal rate (Vmax) values were calculated from a plot of the initial reaction rates vs substrate concentration using Kaleidagraph (SYNERGY Software) ... the data to the Michaelis-Menten equation All reducing sugar assays included a glucose standard curve The average molecular mass of the XG oligosaccharides (XGOs) was calculated from...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo khoa học: Genomic structure, expression and characterization of a STAT5 homologue from pufferfish (Tetraodon fluviatilis) ppt
... mut STAT5 AGATTTCTAGGAATTCAATCC AGATTTAGTTTAATTCAATCC STAT6 CCGCTGTTGCTCAATCGACTTCCCAA GAACA CCGCTGTTGCTCAATCGACTAGCCAA GAACA GCCGTGTAGTTTCTTGGAAATTTCTGG GCCGTGTAGTTTAGATTAAATTTCTGG mut STAT6 Int16 ... CATGTTATGCATATTCCTGTAAGTG CATGTTATGCATATTGGAGTAAGTG STAT3 mut STAT3 GATCCTTCTGGGAATTCCTAGATC GATCCTTCTGGGCCGTCCTAGATC STAT4 mut STAT4 GAGCCTGATTTCCCCGAAATGATGAGC GAGCCTGATTTCTTTGAAATGATGAGC...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot
... this gene was designated naoA (nitroalkane-oxidizing enzyme gene) Expression of naoA in E coli To study the function of the naoA gene, it is necessary to obtain an adequate amount of NaoA protein ... recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers (phospho...
Ngày tải lên: 31/03/2014, 08:20