Oxidative stress regulates DTNBPI dysbindin 1 expression and degradation via a pest sequence in it s c terminus

... HindIII sites including the predicted core promoter of dysbindin- 1A was isolated using a forward CAGTCTCGAGAGGACTGGGGATGTCACTCA-3’) primer and reverse (5’primer (5’- GTACAAGCTTAACCCAGCCTTCTCCAAG-3’) ... PEST sequence on Dysbindin- 1 expression in vitro PEST sequence under oxidative stress was investigated using SH-SY5Y human neuroblastoma cells that stably overexpres...

Ngày tải lên: 01/10/2015, 17:27

... glycoxidation product N(epsilon)-(carboxymethyl)lysine in human tissues in diabetes and aging J Clin Invest 1997, 99:457-468 Le Maitre CL, Freemont AJ, Hoyland JA: The role of interleukin-1 in ... Freemont AJ: Interleukin-1 receptor antagonist delivered directly and by gene therapy inhibits matrix degradation in the intact degenerate human intervertebral disc: an in situ...

Ngày tải lên: 09/08/2014, 10:23

... Figure proteins in vaccinia virus infected human and heat shock RT-PCR1analysis of the heat shock factor blood macrophages RT-PCR analysis of the heat shock factor and heat shock proteins in vaccinia ... of interleukin 12 and interleukin 10 expression in vaccinia virus- infected human monocytes and U-937 cell line Cytokine 2000, 12 :900-...

Ngày tải lên: 11/08/2014, 08:21

... Systemic hypothermia superimposed on endotoxemic challenge further increases microvascular thrombus formation in vivo This involves an increase in circulating PAI-1 expression rather than being ... resulted in a marked increase in the expression of P-selectin and PAI-1 within the microvascular endothelium In endotoxemic animals endothelial PAI-1 expres...

Ngày tải lên: 13/08/2014, 03:20

... time of infection with cGMP agonists -8-pCPTcGMP and Sp-8-pCPT -cGMP or cGMP antagonist (Rp-8pCPT-cGMPs) Culture supernatants were collected every third day and assayed for virus production by RT ... resulted in dose dependent increase in viral protein expression Expression of FLAG-tagged transfected PKG1β (top panel) and HIV-1 viral proteins are shown by Western bl...

Ngày tải lên: 13/08/2014, 05:22

... nucleotide exchange factor with activity towards Ras Results HEK293 cells express the guanine nucleotide exchange factor Ras-GRF1 The guanine nucleotide exchange factor Ras-GRF1 is mainly expressed in ... physiological role of the guanine nucleotide exchange activity of the truncated forms is not known as they are missing the Ca2+ ⁄ CaM-bindin...

Ngày tải lên: 19/02/2014, 18:20

... relatively low amount of cystatin F produced by U937 cells reported earlier [5] is an underestimate of the real production of cystatin F in U937 cells The high portion of intracellular cystatin F led ... production of cystatin F compared to the ubiquitous inhibitor, cystatin C, we measured the cystatin contents in cell lysates and culture media o...

Ngày tải lên: 21/02/2014, 01:21

... exclusively of AATs from prokaryotes, including AATs from proto- Identification of a new aspartate aminotransferase zoa, archaebacteria and bacteria Interestingly, plants also have Ib subgroup-prokaryote-type ... mean ± SD of three determinations B subtilis B3 AATB3 Substrates L -aspartate L-glutamate a- ketoglutarate Oxaloacetate Fig Characterization of the purifi...

Ngày tải lên: 14/03/2014, 23:20

... MAP kinase, Rho mediates growth factor-dependent activation of c-fos via the serum response factor (SRF) [30] Protein kinase C-related kinase (PRK1), also termed protein kinase N (PKN), and PRK2 ... the proliferation of human and rat vascular smooth- muscle cells Biochem J 283, 403–408 Saward, L & Zahradka, P (1997) Coronary artery smooth muscle in culture:...

Ngày tải lên: 17/03/2014, 09:20

... regulation by bile < /b> acids < /b> in human hepatoma cells Cholic acid and chenodeoxycholic acid (CDCA) are two major primary bile < /b> acids < /b> detected in human bile < /b> [19– 21] The effects of bile < /b> acids < /b> on HBV gene expression ... Authors Journal compilation ª 2010 FEBS H Y Kim et al Bile < /b> acid metabolism and HBV gene expression Fig The effect o...

Ngày tải lên: 22/03/2014, 21:21

... sugars produced Michaelis constant (Km) and maximal rate (Vmax) values were calculated from a plot of the initial reaction rates vs substrate concentration using Kaleidagraph (SYNERGY Software) ... the data to the Michaelis-Menten equation All reducing sugar assays included a glucose standard curve The average molecular mass of the XG oligosaccharides (XGOs) was calculated from...

Ngày tải lên: 23/03/2014, 21:20

... mut STAT5 AGATTTCTAGGAATTCAATCC AGATTTAGTTTAATTCAATCC STAT6 CCGCTGTTGCTCAATCGACTTCCCAA GAACA CCGCTGTTGCTCAATCGACTAGCCAA GAACA GCCGTGTAGTTTCTTGGAAATTTCTGG GCCGTGTAGTTTAGATTAAATTTCTGG mut STAT6 Int16 ... CATGTTATGCATATTCCTGTAAGTG CATGTTATGCATATTGGAGTAAGTG STAT3 mut STAT3 GATCCTTCTGGGAATTCCTAGATC GATCCTTCTGGGCCGTCCTAGATC STAT4 mut STAT4 GAGCCTGATTTCCCCGAAATGATGAGC GAGCCTGATTTCTTTGAAATGATGAGC...

Ngày tải lên: 31/03/2014, 07:20

... this gene was designated naoA (nitroalkane-oxidizing enzyme gene) Expression of naoA in E coli To study the function of the naoA gene, it is necessary to obtain an adequate amount of NaoA protein ... recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers (phospho...

Ngày tải lên: 31/03/2014, 08:20