... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... helices AV and BV at the surface of domain V Gly621 and Gly617 are in the area of contact with the 1095 and 2473 regions of 23S RNA The two helices are facing the ribosome, and the four-stranded ... Crystallography ˚ A first 2.1 A resolution apo dataset was collected at the PXII beamline, Swiss Light source (Villigen, Switzerland), ˚ with a Pilatus detector Later, a 1.9 A resolution dataset was...
... redress (n): s a sai, uốn nắn, sư đền bù, bồi thường totalitarian (adj): chuyên chế subordinated to (v): làm cho phụ thuộc vào slanderous (adj): vu khống, phỉ báng misconduct (n): hành vi sai trái thoughtlessness ... (n): hành vi sai trái thoughtlessness (n): vô ý thức, nông cạn, hời hợt 10 conscious (adj): biết được, nhận ra, có ý thức ...
... charge anda region of partial negative charge • are a main reason for melting and boiling point differences between polar and non-polar molecules • include hydrogen bonding, as an example of ... for shapes of molecules Valence Bond (VB) Theory explains bond formation and molecular shapes based on orbital overlap • The region of overlap has a maximum capacity of two electrons, which have ... solids at room temperature and are hard and brittle Examples: NaCl, CaCl2, K2O Size of Na+ ion is smaller than Cl- ion WHY?? Why Ionic Compounds exist as Crystals? Positive and negative ions attract...
... resistor and µF standard capacitor at measurement frequency of 0.1 Hz Asa consequence of this small phase angle standard deviation, the capacitance of standard semiconductor samples can be determined ... of capacitance start to occur 41 Figure 3.9 Capacitance and Phase angle measurement of 100 Ohm // 100 nF standard sample Median and error bar (standard deviation of data) is taken ... as on the applied AC voltage amplitude The phase angle standard deviation was around mili degrees tested by a standard samples which consists of parallel connected 100 Ohm standard resistor and...
... the peak rate of heat release is at 357 degree crank angle and on retarding by and degrees, the peak heat release rate is found at 362 and 363 degrees against 361 degree with standard timing ... over many other vegetable oils in terms of engine performance, emissions, ease of use and availability Jatropha curcas, locally known as ratanjyot, belongs to the family of Euphorbiaceae It is a ... laboratory using standard test procedures as per ASTM/BIS and are listed in Table The properties tested were relative density (standard RD bottles of 50 ml capacity), calorific value (adiabatic...
... tip of the red, positive lead on the positive side ofa battery Put the tip of the black, negative, lead on the other end ofa battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... important function ofa multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 Copyright...
... tip of the red, positive lead on the positive side ofa battery Put the tip of the black, negative, lead on the other end ofa battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... important function ofa multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 Copyright...
... subunits and a- BTX distinguished two major classes of nAChRs: a major population of a- BTX binding a7 * nAChRs which is mainly localized perisynaptically, anda less abundant population of a3 * nAChRs ... oocyte-expressed human nAChR subunit combinabrain [64] and has proven to be a powerful radioligand in tions and seems to have a similar selectivity and activity as numerous binding and autoradiography studies ... ligand-binding domain of the a6 subunit and the transmembrane and intracellular domains of the a3 subunit was used in this study PIA selectively blocks rat and human nAChRs that contain a6 b2 interfaces (with...
... conformation [3] Here we report ROA measurements on b- and j-casein Although measurements were also attempted on aS1 - and aS2 -casein, these proteins had a tendency to aggregate in the laser beam, ... study has shown that the casein milk proteins, the brain proteins synuclein and tau, as well as mutants of a- synuclein and tau associated with inherited forms of neurodegenerative disease, all have ... mainly to local conformational features [18] MATERIALS AND METHODS ROA spectroscopy Materials The b-casein was prepared from whole acid casein by the urea fractionation method of Aschaffenburg [35]...
... stretch of C-terminal acidic amino acids of translational release factor eRF1 is a primary binding site for eRF3 of fission yeast RNA 4, 958–972 Ebihara K & Nakamura Y (1999) C-terminal interaction of ... were obtained for more than 99% of the 1H, 13C and 15N atoms of the protein backbone, and for more than 78% of the side chain atoms The main set of backbone u and w dihedral angles was calculated ... Frolova L (2003) Termination of translation: interplay of mRNA, rRNAs and release factors? EMBO J 22, 175–182 Stansfield I, Jones KM, Kushnirov VV, Dagkesamanskaya AR, Poznyakovski AI, Paushkin...
... graphical comparison of the experimentally measured parameters against simulated datasets (Fig 4) Data indicated by gray squares were simulated using the extended Lipari and Szabo [37] and axially ... experimental restraints, and analyzed with aqua and prochek-nmr software [64] Structure visualization and analysis were carried out using the insightii software package (Accelrys Software Inc., San ... acids of translational release factor eRF1 is a primary binding site for eRF3 of fission yeast RNA 4, 958–972 Ebihara K & Nakamura Y (1999) C-terminal interaction of translational release factors...
... partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 3505 the rate constants for the slow and fast phase of the reaction Analysis was ... 5¢-CGGAACCCCGCAGGTCGAGTTTCC-3¢ and 5¢-GA CGAGGTGCTCGGGGCTCTT-3¢; Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ The mutation (codon underlined above) was confirmed by DNA ... (for glutathione reductase, glutathione synthase and L-lactate dehydrogenase), SDTG (98.2 nmol) and enzyme (typically units) Kinetic analysis Steady -state kinetic measurements of native and SDTGmodified...
... oleic acid [2] The complex was named HAMLET and was defined asa complex between partially unfolded a- lactalbumin and oleic acid Human a- lactalbumin is a globular 14.2 kDa milk protein (123 amino acids), ... [48,49], accompanied by cytochrome c release, proapoptotic caspase activation and exposure of phosphatidylserine on the cell surface [49] Apoptosis was not the cause of cell death, however, as caspase ... side chains of asparagines 82, 84, 87 and 88 and lysine 79 [14] The a- helical domain contains three major ahelical (amino acids 5–11, 23–34 and 86–98) and two short 310-helical domains The smaller...
... end ofa signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was usedasa template with upstream and downstream primers containing, ... N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were used ... the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used to synthesize...
... vaccines was based on a Jennerianapproach prompted by studies indicating that animal and human rotaviruses share a common group antigen and that experimental animals immunized with human strains of ... After a h incubation at 37°C, the inoculum was aspirated and ml ofa 3.5% agarose (Seakem, Biowhittaker, Rockland, ME) in MEM was overlayed on the monolayer The agar was allowed to solidify at room ... strain to those of the other simian rotavirus strains, SA11 and RRV Materials and methods Rotavirus isolation The YK-1 strain of simian rotavirus was isolated from the diarrheal stool ofa 2-year-old...
... ultrastructure was analyzed from the electron micrographs as described by Aro et aL, (1986) and Vapaavuori (1986) On an average, typi- cal chloroplasts were analyzed sample of the replicate plots ... chloroplast ultrastructure, and leaf characteristics of high- and low-light plants andof sun and shade leaves Photosynth Res 2, 115-141 light E.M (1986) Correlation of activity and amount of ribulose ... season, the chloroplast ultrastructure acclimated to decreased light (Fig 2B) and the low rates of C0 uptake (Fig 2A) were possibly caused by altered thylakoid structure typical of shade plants...