Playing with tension a computational mode of improvisational accompaniment by secondary rhythmic performer in carnatic music

... development and validation of a tension model that, assuming restricted sowkhyam, is able to generate alternate variations of secondary accompaniment that are as valid as the original accompaniment ... the database Since each rhythm in the database is distinctly characterized by a single set of accompaniment values, there is always only one accompaniment available fo...

Ngày tải lên: 30/09/2015, 10:11

... the interaction of PCPs with membranes was predominantly in uenced by initial electrostatic interactions, whereas the interaction of PFPs with membranes was most affected by hydrophobic interactions ... other Central proline in amphipathic a- helix amphipathic a- helical peptides such as magainin [52,53], the initial binding of M17P (K1 ¼ 6.8 · 104 m)1) was much f...

Ngày tải lên: 23/03/2014, 10:21

... responses in patients with staphylococcal septicemia against two Staphylococcus aureus fibrinogen binding proteins: clumping factor and an extracellular fibrinogen binding protein Clin Diagn Lab ... IgG antibody levels against PG and TA in sera from healthy individuals and patients with deep-seated and superficial staphylococcal infections S aureus cell wall He...

Ngày tải lên: 02/11/2012, 11:08

... Bing Liu, Johan Bos and Malvina Nissim, and Jimmy Lin and Dina DemnerFushman for making their data available References Kisuh Ahn, Johan Bos, James R Curran, Dave Kor, Malvina Nissim and Bonnie ... forms and postulated a new classification for them My present efforts are on the creation of a gold standard data set for the extraction task As superlatives are particularly frequent in ency...

Ngày tải lên: 20/02/2014, 12:20

... construals of the same information in the process of conventional imagery (thesis 5) LEVEL OF SPECIFICITY The level of specificity of conventional imagery addresses the issue of the degree of detail ... DEPICTIONS Here the x-axis points direction of the halfaxis of the particular side of the reference axis in the DCS; and in the case of "in front o...

Ngày tải lên: 20/02/2014, 21:20

... lexical knowledge base, along the lines of Navigli and Lapata (2010) At its core, the API leverages an in-house Java library to query paths and create semantic graphs with BabelNet The latter ... Thanks to carefully designed Java classes, we are able to accomplish all of this in about 20 lines of code Multilingual WSD API We use the BabelNet API as a framework to b...

Ngày tải lên: 07/03/2014, 18:20

... two training hypotheses listed in Table 2, yielding two models, B and J Table shows the increasing accuracy of both models in describing the text reuse in Ltrain as more features are incorporated ... global linear models in (Collins, 2002), we cast this task as learning a mapping F from input verses x ∈ X to a text- reuse hypothesis y ∈ Y ∪ { } X is the set of verses in t...

Ngày tải lên: 08/03/2014, 02:21

... person, or simply out of habit Conclusions This paper has presented a computational model of the sodal perlocutionary effects of speech acts Our model extends previous formal modela of speech acts to ... part of text generation systems Our M o d e l There are two key questions to address in forming a computational model of social perlocutions: • What are the possible s...

Ngày tải lên: 08/03/2014, 05:21

... Semantic patterns in complex noun phrases fall into two types: part names and other noun phrases Names for pieces of equipment often contain complex noun sequences, i.e stacked nouns The relationships ... sequences A major feature of noun phrases in this set of messages is the presence of many long sequences of left modifiers of nouns, (3) {3) (a) forward kingpost...

Ngày tải lên: 08/03/2014, 18:20

... J (1985a) WAGs as a Grammatical Formalism for Generation", pr~eedings of the 23rd Annual Meeting of the Association for Computational Linguistics, University of Chicago McDonald D & Pustejovsky ... Its implications for natural language generation", International Journal of Computers and Mathematics, 9(1) Spring 1984 McDonald,D & E I Conklin (in preparation) "At the Inter...

Ngày tải lên: 09/03/2014, 01:20

... appears as The syntax-prosody interface (SPI) is defined as a subset of For instance, the optionality of minor phrase formation follows from the inclusion of ... j < i The admissible prosodic labellings are defined as those which extend the following prosodic rules in (9) (+(~), the mother is constrained to be a major MINOR PHRASING phrase, while in (10) ... two se...

Ngày tải lên: 09/03/2014, 01:20

... KRDmsAF (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC ... (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAG...

Ngày tải lên: 16/03/2014, 04:20

... sulfur sulfur interactions in defining the catalytically competent binding mode of CoA in the active site The pantetheine binding tunnel of biosynthetic thiolase When CoA binds to Z ramigera biosynthetic ... thiolase superfamily The results obtained indicate that the sulfur atoms of both the enzyme and the substrate are important for the...

Ngày tải lên: 16/03/2014, 04:20

... constitute the model of metaphor comprehension are common to many language understanding systems (Schank, Wilks, L)IR group, etc.) The comprehension of metaphor does not require a special set of processes ... the conditions necessary for the strategy to be employed CONCLUSIONS The final part of the paper examines the relationship between metaphor comprehension and existing...

Ngày tải lên: 17/03/2014, 19:20

... the elements of U It is of interest to observe t h a t if p a ( t ) - and s(t,n) = ~ a ( u ) , (4.9) that is, the grade of membership of u in A is equal to the degree of similarity of u to t, ... similarity of u to t, then the degree of typicality of t is unity This is reminiscent of definitions of prototypicality (Rosch, 1978) in which the grade of membership of an...

Ngày tải lên: 17/03/2014, 19:21