a special mode of language

Ngày tải lên: 17/03/2014, 19:20

... was a pragmatic (i.e. UK) version of audio-lingualism; the key difference from the audio- lingual approach was that the language presentation and practice was situationalised and so was always ... account of so-called ‘affective’ factors in language teaching, and UK language teaching was famous for its engaging and ‘fun’ qualities; however, the philosophy of the humanistic approaches was valuable, ... the USA, and particularly championed by Earl Stevick, this movement was based on the assumption that language classes were places of fear for language learners; specifically associated with:...

Ngày tải lên: 16/01/2014, 23:20

... that the learner be modeled as a pop- ulation of "grammars", the set of all principled lan- guage variations made available by the biological en- dowment of the human language faculty. ... grammars Learning, including language acquisition, can be characterized as a sequence of states in which the learner moves from one state to another. Transfor- mational models of language acquisition ... grammars. 2.6 Learning in a Parametric Space Suppose that natural language grammars vary in a parametric space, as cross-linguistic studies sug- gest. 3 We can then study the dynamical behaviors...

Ngày tải lên: 20/02/2014, 19:20

... RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTA TTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢). RTEAyF was designed as such that restriction of the generated tatAyCy–strep ... a common feature of all Tat systems analysed in this way to date [12,21]. Gel-filtration chromatography reveals a TatAyCy complex of  200 kDa Apart from the absence of a TatB component, the ear- lier ... membrane-association of precur- sor proteins in other studies and we favour the expla- nation that the membrane-assocation is nonspecific [26]. Characterization of separate TatAyCy and TatAy complexes...

Ngày tải lên: 16/03/2014, 04:20

... lacks the 3¢-phospho-ADP moiety of CoA, having a pivalate group at the 11-hydroxyl moiety of pantetheine instead (Fig. 1). The acetyl and acetoacetyl thioesters of PP (Ac-SPP and AcAc-SPP) have ... positioning of substrate in the thiolase catalytic pocket. Furthermore, calorimetric assays indicate that the mutation of Cys89 into an alanine significantly decreases the affinity of thiolase towards CoA. ... purification and crystallization Z. ramigera thiolase and its C8 9A mutant were expressed and purified as previously described [2,9]. Crystallization of wild-type thiolase and its C8 9A variant were carried...

Ngày tải lên: 16/03/2014, 04:20

... nóng ẩm quanh năm. Độ ẩm trung bình hằng năm từ 80 – 90 %. Thời tiết hai m a m a, nắng. M a m a kéo dài từ tháng tư đến tháng mười. Lượng m a dồi dào, 90% lượng m a tập trung vào m a m a. ĐBSCL ... thông qua các tài liệu có được c a các tác giả đi trước, qua thực tiễn lời ăn tiếng nói hằng ngày c a người dân đ a phương, luận văn nhằm tìm hiểu về định danh từ vựng c a PNNB, đ a ra những ... niệm “sự cố định (hay gắn) cho một kí hiệu ngôn ngữ một khái niệm – biểu niệm (signifikat) phản -47- đ a lí tự nhiên Nam Bộ mà chúng ta đang quan niệm hiện nay. Đây cũng là quan điểm trong việc...

Ngày tải lên: 17/04/2013, 16:09

... such a class is not quite the same as an interface. An interface class has no fields and no method implemen- tations; an abstract base class may have these. Also, multiple interface classes may ... by a class, whereas only one noninterface class may be inherited by a managed type. We want to model radioactive decay. Since most atoms are not radioactive, we don’t want to add radioactivity ... this example. The previous sections demonstrated the declaration and use of managed aggregate types, including ref classes, value classes, managed arrays, enum classes, and interface classes....

Ngày tải lên: 05/10/2013, 08:20

Ngày tải lên: 18/12/2013, 10:03

Ngày tải lên: 25/12/2013, 13:15

... structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates Ramasubramanian Sundaramoorthy 1 , ... suite: programs for protein crystallo- graphy. Acta Crystallogr D Biol Crystallogr 50, 760–763. 28 Navaza J (1994) Amore – an automated package for molecular replacement. Acta Crystallogr A 50, 157–163. 29 ... be an associated water molecule. Our interpretation was that the smaller compound PEA (Fig. 1B) and a water molecule are present and PEX and PEA refined satisfactorily with occupancies of 0.7 Table...

Ngày tải lên: 19/02/2014, 05:20

... explore how an IR system can itself provide a degree of creative anticipation, acting as a mediator between the lit- eral specification of a meaning and the retrieval of creative articulations of this ... expansion. Fortunately, statistical corpus analysis is an ob- vious area of overlap for IR and FLP. Distribu- tional analyses of large corpora have been shown to produce nuanced models of lexical ... Google ngrams include coffee, raisin, almond, carob and soybean. Ad-hoc categories allow users of IR to remake a category system in their own image, and create a new vocabulary of categories...

Ngày tải lên: 07/03/2014, 22:20

... cellulase of 1091 amino acids with a deduced molecular mass of 118 kDa and a pI of 4.85, displayed a multidomain organ- ization bearing a canonical family 48 catalytic domain, a bacterial type 3a cellulose-binding ... Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales Marta M. Sa ´ nchez, F. I. Javier Pastor and Pilar Diaz Department of Microbiology, Faculty of Biology, University of Barcelona, ... Pla de Recerca de Catalunya (Generalitat de Catalunya), grant 2001SGR- 00143, and by the Generalitat de Catalunya to the ÔCentre de Refere ` ncia en BiotecnologiaÕ (CeRBa). M. Sa ´ nchez is a...

Ngày tải lên: 08/03/2014, 02:21

... Introduction Parameter estimation is fundamental to many sta- tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large ... is a version of Boosting with Lasso (L 1 ) regularization. We first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. ... 2007. c 2007 Association for Computational Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao * , Galen Andrew * , Mark Johnson *& ,...

Ngày tải lên: 08/03/2014, 02:21

... acquisition. 2 The Language Domain Database The focus of the language domain database, (hereafter LDD), is to make readily available the different word order patterns that children are typically exposed ... All grammar settings and annotations are saved and available the next time the user logs on. Finally on the Data Download page, users may download data so that they can use the patterns and ... Selection and Data Download. First a user has to specify, on the Grammar Selection page, which settings of the 13 parameters are of interest and save those settings as an available grammar. A user...

Ngày tải lên: 08/03/2014, 04:22

... The Ashanti are an AKAN-speaking people of central Ghana and neighboring regions of Togo and Ivory Coast, numbering more than 900,000. They subsist primarily by farming cacao, a major cash ... structure at the point of attachment. /s NP ¢ V P 1lie Ashanti V- ~NP N /• ~N Akan-speaking Figure 8 Attachment of 0ar~uage #>Akan) 5, Comparisons with other Research in Language Generation ... relative clauses, not all full clauses can be reduced to participial adjectives. 2. The characteristics of the available attachment points, especiafly the grammatical constraints that they...

Ngày tải lên: 09/03/2014, 01:20

... influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table 1 and remain invariable all the rest of parameters. The obtained results are shown ... Abstract. Solving the system of equations describing the stationary operation of a two -mode random microlaser we have found the transformation of saturated values of mode intensity when laser ... photon densities of mode 1 and 2. These equations (1), (2) have been solved numerically by the Matlab language with chosen values of parameters shown in Table 1 (as seen in [12]). Table 1. 1 1...

Ngày tải lên: 14/03/2014, 13:20

... Leidy's "Human Anatomy," and Sappey's "Traité d'Anatomie" have been followed on all anatomical questions, and have furnished many beautiful drawings. Huxley's ... of solid oak.] and also a larger surface for the attachment of the muscles. The Composition of the Bones at maturity is about one part animal to two parts mineral matter. The proportion varies ... manhood, and are a cause of lifelong regret. The use of a strained limb may permanently damage it. Some silly feat of strength may produce an irreparable injury. A thoughtless hour of reading...

Ngày tải lên: 15/03/2014, 13:20

Ngày tải lên: 16/03/2014, 23:20

Ngày tải lên: 17/03/2014, 02:20