Detection of biologically relevant anions by fluorescence and NIR molecular probes
Detection of biologically relevant anions by fluorescence and NIR molecular probes
... DETECTION OF BIOLOGICALLY RELEVANT ANIONS BY FLUORESCENCE AND NIR MOLECULAR PROBES QUEK YI LING (B Sc.(Hons.), National University of Singapore) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Results and discussion .140 6.3.1 Synthesis of complexes and 140 6.3.2 Spectroscopic characterization of complexes and .142 6.3.3 Comparison of NIR band shif...
Ngày tải lên: 30/09/2015, 06:14
Multi wall carbon nanotubes (MWCNTs) doped polypyrrole DNA biosensor for label free detection of genetically modified organisms by QCM and EIS
... screening in DNA detection approach (this approach is more often used than the second one of protein detection because DNA stability is much higher than that of proteins and therefore DNA detection ... study, we described the setup of a novel DNA label- free electrochemical biosensor for GMO (soybean) detection, based on MWCNT -doped PPy matrices for ODN immob...
Ngày tải lên: 02/07/2014, 14:14
Báo cáo khoa học: Glycation and glycoxidation of low-density lipoproteins by glucose and low-molecular mass aldehydes Formation of modified and oxidized particles pot
... glucose and two aldehydes (MG and GA) in inducing lipid and protein oxidation and antioxidant depletion of LDL particles as well as glycation of the apoB protein by measuring specific parameters of ... course, and extent of the covalent and oxidative changes that occur on LDL particles exposed to glucose, GA, and MG have been quantified in order to determine t...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: Fluorescence quenching and kinetic studies of conformational changes induced by DNA and cAMP binding to cAMP receptor protein from Escherichia coli ppt
... uorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli Eur J Biochem 270, 14131423 Yu S & Lee JC (2004) Role of residue ... changes induced by DNA and cAMP 19 20 21 22 23 24 25 26 27 28 29 30 31 cAMP -induced allosteric changes in T127I, S128A and T127I S128A mut...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo hóa học: " Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy" pptx
... Cite this article as: Hong et al.: Sensitive and molecular size-selective detection of proteins using a chip-based and heteroliganded gold nanoisland by localized surface plasmon resonance spectroscopy ... determination of a protein Page of Fabrication of the gold nanoisland substrate The gold nanoisland was prepared by the thermal evapo...
Ngày tải lên: 21/06/2014, 04:20
The chart below shows the amount of leisure time enjoyed by men and women of different employment status
Ngày tải lên: 04/10/2012, 10:02
Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx
... slightly The hepatocytes exhibited similar characteristics Effect of chelators on uptake of NTBI The effects of the chelators on NTBI uptake by hepatocytes and Q7 hepatoma cells were marked and similar ... Characterisation of citrate and iron citrate uptake by cultured rat hepatocytes J Hepatol 29, 603–613 27 Trinder, D & Morgan, E.H (1997) Inhibition of...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: Oxygen-dependent regulation of hypoxia-inducible factors by prolyl and asparaginyl hydroxylation pdf
... mechanism of regulation of both domains involves a common iron dependent process [74,75,79] Regulation of HIFa subunits by oxygen-dependent prolyl and asparaginyl hydroxylation A variety of oxygen ... Moreover, Fig Regulation of hypoxia inducible factors (HIF) by oxygen-dependent hydroxylation In oxygenated conditions (normoxia) the asparaginyl and HIF...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx
... Compound Nouns based on Character Cooccurrence and Its Evaluation (in Japanese) Journal of Natural Language Processing, 4(3):83-99 Masahiro Oku 1994 Handling Japanese Homophone Errors in Revision ... of elements of the homophone set increases Our method has an advantage that the size of DL1 is smaller The size of the decision list has no relation to the precision and th...
Ngày tải lên: 22/02/2014, 03:20
Tài liệu Báo cáo Y học: Regulation of transcription of the Dnmt1 gene by Sp1 and Sp3 zinc finger proteins doc
... through the same GA motif Sp1 and Sp3 bound to the same cis-element in the promoter of the gene for Dnmt1 Therefore, we next examined whether activation by Sp1 or by Sp3 affect expression of the gene ... stimulated by either pPacSp1 or pPacUSp3 (Fig 4C,D) These results indicate that both Sp1 and Sp3 enhanced transcription from the Dnmt1 promoter...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc
... lysed in 100 lL of SDS/PAGE sample buffer by boiling for min, proteins were resolved by means of 7.5% SDS/PAGE and analysed by immunoblotting with monoclonal anti-(P-Tyr) antibody followed by ... Evidence of a laminin binding protein on the surface of Leishmania donovani Biochem Biophys Res Commun 226, 101–106 Ghosh, A., Bandyopadhyay, K., Kole, L & Das, P.K (1999) I...
Ngày tải lên: 08/03/2014, 23:20
Find-A-Ride: A listing of TLC Licensed Bases by Borough and by Zip Code pdf
... OCEAN AVENUE 718-676-0126 Paratransit B90605 ALMAZ TRANSPORTATION INC 2313 AVENUE X 718-769-5600 Paratransit B90537 ALTA MEDICAL TRANSPORTATION, INC 2834 CONEY ISLAND AVENUE 212-202-5555 Paratransit ... FIRST CLASS C/L SVC CORP 4980 BROADWAY NEW YORK, NY Last updated Thursday, February 07, 2013 Page of 70 Manhattan Name of Base Street Address Telephone Base Type License # SEAMAN RADIO DIS...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... of polyneuridine aldehyde into epi-vellosimine This central reaction of the pathway is catalysed by the enzyme polyneuridine aldehyde esterase (PNAE) The...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... BA & Maki M (20 03) Analysis of epidermaltype transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytes using monoclonal antibodies J Dermatol Sci 32 , 95–1 03 ... Baxa U & Steinert P (20 03) Roles of calcium ions in the activation and activity of the transglutaminase enzyme J Biol Chem 278, 238 34– 238 41 30 Hitomi K, Presland RB,...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: "Unsupervised Detection of Downward-Entailing Operators By Maximizing Classification Certainty" docx
... smaller list of NPIs as a seed set Begin with a small set of seed NPIs Iterate: (a) Use the current list of NPIs to learn a list of DEOs (b) Use the current list of DEOs to learn a list of NPIs Interestingly, ... as a generalization of this evaluation procedure that is sensitive to the ranking of DEOs and non-DEOs For development purposes, we use the list of 150 annotations...
Ngày tải lên: 31/03/2014, 20:20