A statistical argument for the homophony avoidance approach to the disyllabification of chinese
... English, Japanese and Hawaiian Among these five languages, Japanese and Hawaiian are known as languages with a few syllable types; Mandarin and Cantonese are the language with a moderate number of syllable ... of the motivation of disyllabification of Chinese The HA approach has been argued to be the motivation of the disyllabification of Chinese (Karlgre...
Ngày tải lên: 26/09/2015, 09:57
... not performed because no real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted ... Aa fitted aa actual aa fitted 3 2 1 Time C 8 D 12 12 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of...
Ngày tải lên: 13/08/2014, 16:21
... conclusions The statistical approach In this section, we will describe the two-pass statistical model, parameters training and Viterbi algorithm for the search of the best sequences of POS tagging ... one of the N-best POS tagging result of the sentence is: T = NN VBD RB CD NNS NN NN For this POS sequence, the 2nd pass will try to determine the baseNPs as show...
Ngày tải lên: 08/03/2014, 05:20
A statistical model for the transmission on infectious diseases
... Ontario, Canada Baltimore, USA England and Wales Netherlands West Germany Poland USA Netherlands England and Wales Nairobi, Kenya Kampala, Uganda Hong Kong Ontario, Canada Singapore Vietnam Time ... (TSIR) model Then we check the validation of the TSIR model and investigate the relationship between the parameters in the TSIR model and the classical mathematical epidemic mod...
Ngày tải lên: 26/09/2015, 09:57
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... obesity and chronic diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings togeth...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... Annals of Mathematics, 167 (2008), 701–766 A shape theorem for the spread of an infection By Harry Kesten and Vladas Sidoravicius Abstract In [KSb] we studied the following model for the spread ... movement of all the other particles In the present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths...
Ngày tải lên: 16/02/2014, 06:20
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... faculty of growing either as parasites or saprophytes, in which case they are known as facultative parasites or saprophytes The great majority of bacteria of interest in dairying belong to the ... together with a limited amount of mineral matter The nitrogen and carbon are most available in the form of organic compounds, such as albuminous material Carbon in the...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management. ") ... selection of education, marketing, and law as sets of tools that can be brought to bear on the management of public health and social...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... Effects of hypoxia on HO-1 and HO-2 expression in human cell lines We initially analyzed the effects of hypoxia on the expression of HO-1 and HO-2 in human cell lines of Reduced expression of heme oxygenase-2 ... we have analyzed the effect of hypoxia on the expression levels of HO-1 and HO-2 in various types of human cell li...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae ... glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium th...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... the wave dynamics in the near shore area and in the vicinity of coastal structures. It has been found that the numerical model can satisfactorily simulate the wave transformation, ... to wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existin...
Ngày tải lên: 28/03/2014, 15:20
a novel method for the synthesis of titania nanotubes using
... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...
Ngày tải lên: 05/05/2014, 15:26
a novel method for the synthesis of cao nanoparticle
... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...
Ngày tải lên: 06/05/2014, 08:55