Ngày tải lên: 20/06/2014, 04:20
Ngày tải lên: 23/06/2014, 00:20
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx
... by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis. As such, a score of 0 denotes no available evidence ... 39-year old man suffering with anxiety as a result of residual psychotic symptoms. Clinical Practice Report 5 was an oral presentation of a piece of clinical work completed with staff at a day ... evidence for such a feature, 1 indicates partial evidence, and 2 indicates there was definitely evidence for such a feature in the study. A further adaptation was sorting of the categories...
Ngày tải lên: 12/02/2014, 12:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC VL6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA JH1-2.link...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc
Ngày tải lên: 13/08/2014, 23:20
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... integrated and comprehensive approach towards the promotion of healthy diets and physical activity V.8.1. A coherent and comprehensive approach aimed at making the healthy choices available, affordable ... lack of physical activity are therefore the leading causes of avoidable illness and premature death in Europe. 7. The underlying determinants of the risk factors for the major chronic diseases ... Platform for Action on Diet, Physical Activity and Health IV.1.1. In order to establish a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... present case we can take π B = π A , which has the great advantage that the path of ρ does not depend on the paths of the other particles. This is the reason why the case D A = D B is special. We ... t) has the same distribution at the space-time point (x + y, t + s)asthe full-space process (started at (0, 0)) at the point (y, s). Again we shall use the same random walk paths π A for all the ... basic inequalities remain valid for k = 1 by trivial modifications which we again leave to the reader. For the various estimates we have to take all t k large. This will automatically be the case...
Ngày tải lên: 16/02/2014, 06:20
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... upon arrival at the farm, so that the conditions are favorable for rapid fermentation. Many of the taints that bother factories are directly traceable to such a cause. A few dirty patrons will ... made in an approximate manner so as to serve as a test at the weigh-can or intake. The test is best made by the use of the well known alkaline tablet which is composed of a solid alkali, and ... hydrogen, carbon, oxygen, together with a limited amount of mineral matter. The nitrogen and carbon are most available in the form of organic compounds, such as albuminous material. Carbon in the form...
Ngày tải lên: 16/02/2014, 22:20
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... have changed dramati- cally in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed. The re- lationship of behavior management and externalities ... act as managers wish. If a libertarian were to allow any form of " Carrots, Sticks, and Promises / 29 a good understanding of and accommodate the target's MOAs and the trade-off of ... to increase the health of the population and lower the cost of health care than can treatment of illness. In this article, a conceptual framework is proposed for the management of public health and...
Ngày tải lên: 18/02/2014, 02:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... 1162–1168. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase-1 by hypoxia in vascular endothelial cells. ... HepG2 and HeLa cells were cultured for 48 h under normoxia or hypoxia, and then harves- ted. The microsome fraction was prepared and used for the assay of HO activity. The data are means ± SEM of ... the maintenance of intracellular heme level Yongzhao Zhang 1 , Kazumichi Furuyama 1 , Kiriko Kaneko 1 , Yuanying Ding 1 , Kazuhiro Ogawa 2, *, Miki Yoshizawa 1 , Masaki Kawamura 1 , Kazuhisa Takeda 1 ,...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... olig- omerization, aggregation and fibrilization that Ab forms amyloid plaques. As amyloid plaques are prom- inent in the postmortem AD brain, early research the- ories placed the accumulation of extracellular, insoluble ... ablated [41]. Amyloid-b After the 4.5 kDa Ab peptide was identified as a major component of the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent ... that could be expected within the brain. The capacity for metals to facilitate this process may therefore be a critical factor in the Ab mediated pathology of the AD brain. Subse- quent to an...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... 5Â-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3Â; and 3rev- Gulox (reverse), 5Â-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3Â. The PCR product was ... respectively, as a direct electron acceptor. The animal and plant l-gul- onolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate. Only scarce data are available on the ... horizontal transfer of vitamin C-related genes. In the process of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Maruyama S, Takahara M, Miyagishima SY, Mori T, Nishida K, Yagisawa F, Nishida K, Yoshida Y et al. (2004) Genome sequence of the ultrasmall unicellular red alga Cyanidioschyzon merolae 10D. Nature ... that Prasinophytes also contain PsbQ. The thylakoid membranes of P. parkeae and E. gracilis did not react with any antibodies against the red algal and cyanobacterial extrinsic proteins (lanes ... heme c attached. These recombinant proteins were used for pre- paration of the antibodies against red algal PsbQÂ, PsbV and PsbU, cyanobacterial PsbU and green algal PsbQ. The antibodies against...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: "AN EXPERT SYSTEM FOR THE PRODUCTION OF PHONEME STRINGS FROM UNMARKED ENGLISH TEXT USING MACHINE-INDUCED RULES" pdf
... English as a Second Language Foreign Language Building 707 S. Mathews Urbana, IL 61801 U.S .A. ABSTRACT The speech synthesis group at the Computer- Based Education Research Laboratory (CERL) of ... University of Illlnols at Urbana-Champalgn Computer-based Education Research Laboratory 103 S. Hathews Urbana, IL 61801 U.S .A. Wayne B. Dickerson University of Illinois at Urbana-Champalgn ... evaluated and the proper branch is then selected on the basis of values of the word features. The process is repeated until a leaf node of the tree is reached. The leaf node contains the value...
Ngày tải lên: 24/03/2014, 05:21
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in the nearshore area obtained by Ting and Kirby ... of the coastalstructures. Zero gradients of k and ε are assumed at the offshore, lateral boundaries and at surfaces of coastalstructures. A scheme similar to that of ... (TKE) generation is assumed as the sum of those respectively due to wavebreakingandhorizontalandverticalshear. The verification of the numericalmodelagainstdataobtainedfromvariousindoorexperiments reveals...
Ngày tải lên: 28/03/2014, 15:20
Báo cáo khoa học: "Adding Syntax to Dynamic Programming for Aligning Comparable Texts for the Generation of Paraphrases" potx
... sentences instead of on their parse trees. Because of the se- mantic discrepancies among the inputs, applying syntactic features in the alignment has a larger im- pact on the grammaticality and fidelity of the ... 2006. c 2006 Association for Computational Linguistics Adding Syntax to Dynamic Programming for Aligning Comparable Texts for the Generation of Paraphrases Siwei Shen , Dragomir R. Radev , Agam Patel ... say the aircraft was a Piper tourism plane with only the pilot on board. 14. Police say the plane was an Air Commando 8212; a small plane similar to a Piper. 15. Rescue officials said that at...
Ngày tải lên: 31/03/2014, 01:20