a shell system for the generation of clinical documents

... It means that, we have to calculate the variance of the outputs of Doppler filters, which may have an arbitrary value depending on the variance of the complex Gaussian random variables at the inputs ... random variables with a fixed (unit) variance. Meanwhile, as presented earlier, the variances of the complex Gaussian random variables at the output of the Rayleigh simulator may have arbitrary ... denoted as σ 2 r j are not necessarily equal to one another. Therefore, the sce- nario where the variances of the Rayleigh envelopes are equal to one another and the powers of real parts are equal

Ngày tải lên: 23/06/2014, 00:20

... artefacts and relegate evaluation to a subsequent & separate phase Scant attention to the shaping of IT artefacts by the organizational context Fails that the artefacts emerges from interaction ... IT artefacts are ensembles shaped by the organizational context during development and use Building and evaluating artefacts goes hand in hand Various forms of the organizational context can ... Scholar Analyse steps Title & Abstract screening, Number of citations potentially relevant (Y/N) Available (Y/N) Analysis of article content, for- / backward search  relevant (Y/N) Classification

Ngày tải lên: 10/12/2016, 15:36

... when the baseline signal reaches a steady state; the instrument leads to automated reading of the analytical signal and the consequent data treatment Although the analytical method is based on an ... capable of making quantitative estimations directly on the field and to the rather short times available when receiving the grapes in the wine cellar, the evaluation is nowadays made by visual ... processes affect the taste of the wine finally produced For this reason, the sanitary quality of the grapes has to be very carefully evaluated before any processing Due to the lack of portable instruments

Ngày tải lên: 01/11/2022, 09:54

... Central Page 1 of 18 (page number not for citation purposes) Theoretical Biology and Medical Modelling Open Access Research A method for the generation of standardized qualitative dynamical systems ... has a total mass flux of zero [4,5]. There are cases, however, where the underlying biochemical reactions are not known for large parts of a pathway, but the direction of the flow of information ... cellular states. Indeed, quali- tative and semi-quantitative dynamical models provide valuable information about the global properties of regu- latory networks. The stable steady states of a dynamical

Ngày tải lên: 13/08/2014, 23:20

... differentiation." J Leukoc Biol 74(5):833-845.
 Kuwana, Masataka, Yuka Okazaki, Hiroaki Kodama, Takashi Satoh, Yutaka Kawakami and Yasuo Ikeda. 2006. "Endothelial differentiation potential of human ... Komaki, Qin Li, Toshie Kanayasu-Toyoda, Akiko Ishii-Watabe, Akiko Kobayashi, Teruhide Yamaguchi, Mayumi Abe, Teruo Amagasa and Ikuo Morita. 2008. "A comparison of the tube forming potentials of ... Larghi, Alessandra Mancino, Luca Rubino, Chiara Porta, Maria Grazia Totaro, Monica Rimoldi, Subhra Kumar Biswas, Paola Allavena and Alberto Mantovani. 2008. "Macrophage polarization in tumour

Ngày tải lên: 09/09/2015, 10:13

... “Articles, Facts & Infographics about Alabama Agriculture.” Farm Flavor, Feb 2014, www.farmflavor.com/alabama-agriculture/ Fields, Deacue, et al “Economic Impacts of Alabama’s Agricultural, Forestry, ... catfish and quail, third for forestland, peanuts and sod, and sixth for pecans Forestry is an important part of the state’s agriculture sector Alabama boasts the third most timber acreage in the ... cultural, and environmental characteristics The village of Moore’s Mill is also comprised of adjacent rural agricultural land (such as Lazenby Farms) A city is the entirety of a regions urban area

Ngày tải lên: 21/10/2022, 17:07

... OF A PLACEMENT SYSTEM FOR THE FIRST COLLEGE MATHEMATICS COURSE Gregory Harrell and Andreas Lazari* 1Department of Mathematics, Valdosta State University, Valdosta, Georgia, 31698 alazari@valdosta.edu ... within the registration system DATA ANALYSIS In assessing the math placement, two variables were used, the MATH_PLACEMENT and PASS_DFW The MATH_PLACEMENT has levels 1, 2, 3, and and the PASS_DFW has ... 2018 Statistical abstract of undergraduate programs in the mathematical sciences in the United States Fall 2015 CBMS survey The American Mathematical Society Bressoud, D 2015 Presentation of the

Ngày tải lên: 30/10/2022, 17:47

... total capacitance (Ct) of the sensor can be expressed as: (1) The capacitance of glass wall (Cw) is dependent on the dielectric material of the glass and is a constant, while the actual capacitance ... 1583–1586 17 Bera, S.C.; Chattopadhyay, S A modified Schering bridge for measurement of the dielectric parameters of a material and the capacitance of a capacitive transducer Measurement 2003, ... enormously from recent advances in silicon fabrication technology that allows accurate and repeatable fabrication of miniature capacitance sensors The application of capacitive sensing system now includes

Ngày tải lên: 02/11/2022, 08:50

... visualize data from CSV file If we changed the way of storing data to database, we might as well use other libraries that are faster in processing data APPENDIX A Tables This appendix contains tables ... data in a relational database management system (RDBMS) instead of CSV files which is used currently As data increases, a RDBMS is much more efficient than CSV in extracting and organizing data ... from class of 2009 to 2020 and courses in the last seven years (2009-2016) Among the three approaches mentioned before, two of the them (Content-based and Association Rule Learning) are abandoned

Ngày tải lên: 02/11/2022, 14:06

... toward the endothelialization or re-endothelialization of target substrates Statistical predictions for the ageing population of Western Countries foresee a dramatic increase of cardiovascular ... dynamic combinations of flow-generated wall shear stress and wall deformation The wall shear stress and wall deformation values obtained encompass both the physiological and supraphysiological ... (ECs), at the implant’s luminal surface9 Several strategies have been proposed to address the process of endothelialization of artificial materials (i.e metal alloys, plastic polymers, and elastomers)

Ngày tải lên: 19/11/2022, 11:48

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic

Ngày tải lên: 18/06/2014, 16:20

... assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all ... of the project, including organizational and scientific aspects, data analysis and interpretation as well as manuscript... writing and approval All authors read and approved the final manuscript ... and data ana- lysis. Each laboratory performed two parallel assays, one with and one without the inclusion of dump channel markers. The study revealed a clear benefit for the use of a DUMP channel,

Ngày tải lên: 18/06/2014, 22:20

... and data ana- lysis. Each laboratory performed two parallel assays, one with and one without the inclusion of dump channel markers. The study revealed a clear benefit for the use of a DUMP channel, ... contributions SA carried out the collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the ... the discretion of the lab. Data acquisition Individual laboratories acquired the data on their flow- cytometer and analyzed the FCS files following labora- tory-specific analysis strategies and

Ngày tải lên: 20/06/2014, 04:20

... specially considering the lack of video information in our approach R Amaral et al Table 4: Topic indexation results APP ASR Manual Manual Manual Auto Manual Auto w/o conf Auto w/conf Auto w/conf ... yet at the level of the ones for languages like English, where much larger amounts of training data are available The 51 hours of BN training data for our language are not enough to have an appropriate ... have all the facilities of streaming video for different kinds of devices and the availability of metadata is starting to be admissible in most of the streaming software of these devices These

Ngày tải lên: 22/06/2014, 20:20

... vertices are objects of O. The objects having the the electronic journal of combinatorics 14 (2007), #R57 4 same value of the parameter p lie at the same level, and the sons of an object are the objects ... maximal ordinate among all the cells of the polyomino; U2 : the lowest cell of the rightmost column of the polyomino has the minimal ordinate among all the cells of the polyomino. We say that a convex ... his collaborators in [3], is a constructive method to produce all the objects of a given class, according to the growth of a certain parameter (the size) of the objects. Basically, the idea is to

Ngày tải lên: 07/08/2014, 15:22

... CHD and that of the DHD Correlation 4: translation and access of biological information via the DNA transcription machinery One of the limitations of the Central Dogma (and, for that matter, the ... percent of eukaryotic DNA, does not appear to participate in the “classic” Watson and Crick role of DNA as an information repository for protein synthesis; therefore the majority of human DNA appears ... organizational properties may be the same The polyfunctional nature of RNA has already been alluded to; similarly, DNA, in what has Page of 29 D’Onofrio and An Theoretical Biology and Medical

Ngày tải lên: 13/08/2014, 16:20

... Hospitals? Medical Care Research and Review 68(1) 75S-100S. Samaha, Stephen A. and Wagner A. Kamakura, 2008. Assessing the Market Value of Real Estate Property with a Geogaphically Weighted Stochastic ... before they make the decision are not available. Third, the classification of jobs and education level is limited in the sample. The characteristics of households are majorly based on the head of ... school. Unfortunately, such information is not recorded in the dataset. Fourth, the sellers’ information is also not available in the data. The second part of the research considers information

Ngày tải lên: 09/09/2015, 11:33

... by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis. As such, a score of 0 denotes no available evidence ... 39-year old man suffering with anxiety as a result of residual psychotic symptoms. Clinical Practice Report 5 was an oral presentation of a piece of clinical work completed with staff at a day ... evidence for such a feature, 1 indicates partial evidence, and 2 indicates there was definitely evidence for such a feature in the study. A further adaptation was sorting of the categories...

Ngày tải lên: 12/02/2014, 12:20

... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC VL6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA JH1-2.link...

Ngày tải lên: 23/03/2014, 13:20

... integrated and comprehensive approach towards the promotion of healthy diets and physical activity V.8.1. A coherent and comprehensive approach aimed at making the healthy choices available, affordable ... lack of physical activity are therefore the leading causes of avoidable illness and premature death in Europe. 7. The underlying determinants of the risk factors for the major chronic diseases ... Platform for Action on Diet, Physical Activity and Health IV.1.1. In order to establish a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched...

Ngày tải lên: 14/02/2014, 13:20