Roles of siRNAs and miRNAs in host responses to virus infection identification and characterization of a novel viral suppressor of RNA silencing

... demonstrated as a natural antiviral defense in plants Is RNAi also antiviral in animals? Flock house virus (FHV), which can infect both animals and plants, was demonstrated as both an initiator and a ... biogenesis and possible roles of miRNAs and siRNAs 1.3.8 Viral suppressor and miRNA-controlled developmental pathway interaction After discovering miRNAs in...

Ngày tải lên: 16/09/2015, 17:11

... WRKY40 and WRKY60 proteins indeed function in a complex pattern in plant responses to ABA and abiotic stresses The complex roles of the three WRKY transcription factors in plant biotic and abiotic ... al.: Roles of arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic st...

Ngày tải lên: 11/08/2014, 11:21

... first work studying concerted gene expression of sunflower in response to salinity, allowing the identification of genes involved in common regulatory mechanisms to both Page 11 of 18 (page number ... by salt stress per se In another study the expression of 150 genes in response to wounding and insect feeding was carried out [58], finding that some of the...

Ngày tải lên: 12/08/2014, 05:20

... production of interferon-γ, which has been shown during the past several years to be a key effector cytokine in the host response against tuberculosis Th2 cells primarily secrete the cytokines interleukin-4, ... Respiratory Research Vol No Schluger whole cascade of inflammatory events On the other hand, in many infectious syndromes relatively avirulent organisms cause disease main...

Ngày tải lên: 12/08/2014, 18:20

... Cotton GhMPK2 is involved in multiple signaling pathways Results Expression of GhMPK2 was upregulated by oxidative stress and phytohormones To study the effect of oxidative stress and signaling ... Cotton GhMPK2 is involved in multiple signaling pathways A B D C E F Fig Overexpression of GhMPK2 confers increased tolerance to oxidative s...

Ngày tải lên: 14/03/2014, 23:20

... lipid-transfer proteins (nsLTPs) [18] and phytoalexin [19] However, to date information on ESTs expressed in response to the X fastidiosa challenge is lacking The goal of this study was to characterize ... in the grape/ X fastidiosa interaction using the SSH technique to compare populations of mRNA from highly resistant and susceptible grape genotypes from a grape m...

Ngày tải lên: 12/08/2014, 05:20

... set There are 1,364 and 1,323 gene pairs in human and mouse, respectively, in the FAM2 gene set deposited research TAGs are tandemly arrayed genes that belong to the same gene family There are ... of the human gene pairs and 91% of the mouse gene pairs in the NEW gene set have Ks ≤ 0.25, which confirms the recent duplications of these gen...

Ngày tải lên: 14/08/2014, 08:20

... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351 -SUT2 was constructed to contain SUT2 as the ... yeast/ info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACA...

Ngày tải lên: 07/03/2014, 15:20

... and 2.06 Therefore, the polysaccharide has a tetrasaccharide repeating unit containing one residue each of D-Glc and D-Gal and two D-residues of GalNAc The 1H- and 13 C NMR spectra of the polysaccharide ... Assignment of the major series in the 1H and 13 C NMR spectra of the O-deacetylated polysaccharide using 2D COSY and 1H, 13 C HMQC experiments (Table...

Ngày tải lên: 17/03/2014, 17:20

... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... The Authors Journal compilation ª 2007 FEBS 407 Soybean protein disulfide isomerase family H Wadahama et al plant tissues using an RNeasy Plant Mini kit Quantification of mRNA was p...

Ngày tải lên: 30/03/2014, 04:20

... export machinery [29-34] The < /b> N-terminal RNA binding domain binds to < /b> both single- and double-stranded RNA that might inhibit the < /b> activation and/ or signalling of antiviral proteins, such as RIG-I, ... et al.: Differences < /b> in < /b> the < /b> ability < /b> to < /b> suppress < /b> interferon < /b> b production between allele A and allele B NS1...

Ngày tải lên: 11/08/2014, 21:21

... in both standardized anti-MCV and RF-ELISA (Orgentec, Mainz, Germany) The ratio of applied antigens and serum anti-MCV antibodies and/ or RF was such that monodentate binding of autoantibodies ... the anti-CCP2 ELISA Scand J Rheumatol 2008, 37:15 1-1 54 doi: 10.1186/ar3057 Cite this article as: Renger et al., Immediate determination of ACPA and rheumatoid factor...

Ngày tải lên: 12/08/2014, 14:22

... the teacher feedback That is the reason why teachers need to take into account some questions: “What feedback strategies does a teacher actually use when providing feedback on grammatical errors , ... research questions: What are the types of teacher written feedback on the students’ grammatical errors? What are the students’ preferences for different typ...

Ngày tải lên: 04/08/2015, 09:40

... disease primarily through suppression of IL-17, and IL-4 acts by altering the cytokine milieu, phenotype of Th17 cells, and/ or by directly inhibiting bone and cartilage damage Competing interests The ... regulation of IL-17 responses in vivo, we wanted to confirm and evaluate the role of IL-17 in mediating joint inflammation by administering neutralizing antibody to...

Ngày tải lên: 09/08/2014, 14:22