Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 2

... rigid core exert hindrance to self- assembly whereas the pyrimidine groups stabilized the self- assembly of jacketed polymers A series of novel jacketed liquid crystalline polymers, in which the terphenyl ... expected to help the self- assembly of the polymers The length of the alkyl chain and position of the alkyl chain on the mesogenic units appears to have s...

Ngày tải lên: 16/09/2015, 17:11

... of polymers 3a, 3b and 3c were measured in chloroform solution The absorption and emission spectra of the polymers are shown in Fig .5. 3 and the values as given in Table 5. 2 The UV spectrum of ... = 5. 2Hz, CCH(O)-, H), 4 .5 (d, J = 5. 5 Hz, O-CH2-, H), 2.7 (s, -OH, H) 13 CNMR ( 75. 4 MHz, CDCl3, δ ppm) 154 .2, 137.2, 134.7, 127.7, 126.7, 126.0, 1 25. 7, 1 25. 5, 121.0,...

Ngày tải lên: 16/09/2015, 17:11

... CDCl3, δ ppm): 171, 149 .80, 149 .45 , 141 .17, 137.08, 136.62, 135.76, 1 34. 62, 1 34. 49, 133.79, 130.59, 129.33, 128.88, 126.63, 1 24. 90, 1 24. 07, 123 .45 , 113.72, 77.33, 76.91, 76 .48 , 69.11, 31.79, 30.79, ... 2θ1/° 2θ2/° 2θ3/° 2 4/ ° 2θ5/° d1(Å) d2(Å) d3(Å) d4(Å) d5(Å) 2 .46 2.86 P1(DBSA)0.5 3.02 20.1 P1 4. 91 7 .42 19.8 35.9 30.6 29 .4 17.9 11.9 4. 5 4. 4 The XRD diffraction pat...

Ngày tải lên: 16/09/2015, 17:11

... 4H), 3. 86 (s, Ar-O-CH3, 3H), 3. 78 (s, Ar-O-CH3, 3H), 3. 77 (s, Ar-O-CH3, 3H), 2.20 (b, -C-OH, 1H) 13 C NMR (75.4 MHz, CDCl3, δ ppm) 158.7, 151.2, 149.4, 131 .4, 130 .4, 129.7, 129 .3, 114.6, 1 13. 5, ... 150.4, 130 .4, 129.7, 129 .3, 128.9, 127.8, 118.0, 115 .3, 114 .3 (ArC), 69.6 (O-CH2-), 56 .3 (O-CH3), 31 .8, 29.5 (-CH2-), 13. 4 (-CH3) MS (EI): m/z: 474.4, 420 .3, 36 4 .3, 30 7....

Ngày tải lên: 16/09/2015, 17:11

... 131 .2, 124 .4, 122 .0, 117.5, 114.8, 106.4, 92. 4 (Ar-C), 68.8 (O-CH-), 31 .2, 28 .9, 28 .8, 28 .7, 28 .6, 28 .5, 28 .4, 25 .4, 21 .9 20 .2 (-CH2-), 13.8 (-CH3) MS (ESI): m/z: 434.3, 22 6.1, 23 8.1, 21 2.1, ... 131.5, 128 .6, 128 .2, 127 .2, 115.9, 114.6, 106 .2 (Ar-C), 71.7, 69.5 (O-CH-), 318, 29 .5, 29 .4, 29 .3, 29 .2, 29 .1, 29 .0, 25 .9, 22 .6 (-CH2-), 13.9 (-CH3)...

Ngày tải lên: 16/09/2015, 17:11

... enhanced in the selfassembly of the novel polymers 53 2.1.4 Conclusion A series of novel jacketed polymers were synthesized, and characterized using GPC, DSC, TGA, FTIR, NMR, and X-ray diffraction ... properties of jacketed polymers in which the main chain is sterically crowded with laterally attached rigid side chains17-19 Here we report the synthesis of a series...

Ngày tải lên: 16/09/2015, 17:11

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its tar...

Ngày tải lên: 20/02/2014, 11:20

... substitution of poly(4-fluoro-2,5benzophenone) with various nucleophiles .7 1-4 Synthesis of functionalized polythiophenes 1-5 Synthesis of functionalized PLA and PCL 1-6 Synthesis ... 1-6 Synthesis of functional polyesters In the following chapters, the functionalized monomer approach is used to prepare functionalized diene-based materials Synthesis of a wide...

Ngày tải lên: 14/11/2014, 08:10

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... Adsorption of toxic chemicals in aqueous supernatant from Step 2)Chemical Oxidation or Total Mineralization of the the Organics 3)Deep UV Photooxidation of the Organics 4)Photocatalytic oxidation of ... in both dispersed and heterogeneous forms (supported) tsnl Advantanges of this Approach•The light absorption and energy levels of the semiconductor valence and conduction...

Ngày tải lên: 14/03/2014, 20:20

... of the adsorption sites gradually on the nanowires 3.2.2 Response and recovery of the DNA-templated silver nanowires exposed to ammonia The response and recovery of the DNA-templated silver nanowires ... carried out at room temperature Results and discussions 3.1 Fabrication of the DNA-templated silver nanowires The fabrication of DNA-templated silver...

Ngày tải lên: 20/03/2014, 13:08

... preparing bimodal micro- and meso-porous MOF nanocrystals, uniform nanosized MOFs with controlled- shape and size and subsequently, the extensive application of the prepared nanosized MOFs The first objective ... preparation of mesoporous MOF nanocrystals and uniform nanoscale MOFs with desired shape and size 1.2 Objectives of the thesis The aim of this...

Ngày tải lên: 02/07/2014, 13:40

... www.pdffactory.com List of Tables IgE binding rates of the cloned dust mite allergens and their biological properties 22 Overview of the productions of recombinant mite allergens: from the aspects of the production ... mutants of the mites FABP homologues 70 Overview of the characteristics and statistical data of the dust mites EST collections 80 Summary and...

Ngày tải lên: 12/09/2015, 11:08

... STUDY OF THE ASSOCIATED PROTEINS OF STAT3 AND CHARACTERIZATION OF THEIR FUNCTIONS: ROLES OF GRIM- 19 AND PIN1 IN THE REGULATION OF STAT3 ACTIVITY LUFEI CHENGCHEN B Sc (Hons), NUS A THESIS ... fold of human Pin1 37 Figure 3.1 Interaction of Stat3 and GRIM- 19 71 Figure 3.2 Association of endogenous Stat3 and GRIM- 19 75 Figure...

Ngày tải lên: 15/09/2015, 17:10

... 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ 5′ GGTAAAACCTTTTCACAAAATGCTTTTTCGTAATCAC 3′ E58 8A: 5′ GAAATGGTTGAAGGCAACAGCTGAAATTCCTACAGTAG 3′ 5′ CTACTGTAGGAATTTCAGCTGTTGCCTTCAACCATTTC 3′ The following ... CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3' M3-F: 5' CATTACTTGTTTGAAGGAAACTGCAGAAGCTGTTGTCTTCG 3' M3-R: 5' CGAAGACAACAGCTTCTGCAGTTTCCT...

Ngày tải lên: 16/09/2015, 08:30