Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 4
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 6
... rigid core exert hindrance to self- assembly whereas the pyrimidine groups stabilized the self- assembly of jacketed polymers A series of novel jacketed liquid crystalline polymers, in which the terphenyl ... expected to help the self- assembly of the polymers The length of the alkyl chain and position of the alkyl chain on the mesogenic units appears to have significant effect on the self- assembly Besides ... between rigid segments and flexible segments, polar or nonpolar effect is investigated through the incorporation of the polar functional groups A series of novel jacketed polymers were synthesized...
- 4
- 214
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 5
... of polymers 3a, 3b and 3c were measured in chloroform solution The absorption and emission spectra of the polymers are shown in Fig .5. 3 and the values as given in Table 5. 2 The UV spectrum of ... = 5. 2Hz, CCH(O)-, H), 4 .5 (d, J = 5. 5 Hz, O-CH2-, H), 2.7 (s, -OH, H) 13 CNMR ( 75. 4 MHz, CDCl3, δ ppm) 154 .2, 137.2, 134.7, 127.7, 126.7, 126.0, 1 25. 7, 1 25. 5, 121.0, 1 05. 3 (ArC), 69.4 (O-CH-), ... 300 400 50 0 wavelength (nm) Figure 5. 3 UV-vis absorption and Fluorescence spectra of polymers measured in chloroform at room temperature Table 5. 2 The detailed data of UV-vis absorption and Fluorescence...
- 19
- 314
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 4
... CDCl3, δ ppm): 171, 149 .80, 149 .45 , 141 .17, 137.08, 136.62, 135.76, 1 34. 62, 1 34. 49, 133.79, 130.59, 129.33, 128.88, 126.63, 1 24. 90, 1 24. 07, 123 .45 , 113.72, 77.33, 76.91, 76 .48 , 69.11, 31.79, 30.79, ... 2θ1/° 2θ2/° 2θ3/° 2 4/ ° 2θ5/° d1(Å) d2(Å) d3(Å) d4(Å) d5(Å) 2 .46 2.86 P1(DBSA)0.5 3.02 20.1 P1 4. 91 7 .42 19.8 35.9 30.6 29 .4 17.9 11.9 4. 5 4. 4 The XRD diffraction pattern of P1 shows sharp reflection ... formed via host polymers with pyrimidine groups and alkyl sulfonic acid and investigate their self- assembling properties in the solid state 1 14 4.2 Experimental section 4. 2.1 Materials and reagents...
- 26
- 504
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 3
... 4H), 3. 86 (s, Ar-O-CH3, 3H), 3. 78 (s, Ar-O-CH3, 3H), 3. 77 (s, Ar-O-CH3, 3H), 2.20 (b, -C-OH, 1H) 13 C NMR (75.4 MHz, CDCl3, δ ppm) 158.7, 151.2, 149.4, 131 .4, 130 .4, 129.7, 129 .3, 114.6, 1 13. 5, ... 150.4, 130 .4, 129.7, 129 .3, 128.9, 127.8, 118.0, 115 .3, 114 .3 (ArC), 69.6 (O-CH2-), 56 .3 (O-CH3), 31 .8, 29.5 (-CH2-), 13. 4 (-CH3) MS (EI): m/z: 474.4, 420 .3, 36 4 .3, 30 7.2, 247.1, 199 Mp: 1 23 °C ... Hz, -CH3, H) 13C NMR (75.4 MHz, CDCl3, δ ppm) 158 .3, 151.1, 149.68, 137 .4, 130 .6, 130 .5, 129.6, 129.5, 129.4, 129 .3, 128 .3, 127.5, 127.1, 118.5, 117.4, 115 .3, 115.1, 114 .3, 114.0, 1 13. 3, 1 13. 0 (ArC),...
- 31
- 521
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application 2
... 131 .2, 124 .4, 122 .0, 117.5, 114.8, 106.4, 92. 4 (Ar-C), 68.8 (O-CH-), 31 .2, 28 .9, 28 .8, 28 .7, 28 .6, 28 .5, 28 .4, 25 .4, 21 .9 20 .2 (-CH2-), 13.8 (-CH3) MS (ESI): m/z: 434.3, 22 6.1, 23 8.1, 21 2.1, ... 131.5, 128 .6, 128 .2, 127 .2, 115.9, 114.6, 106 .2 (Ar-C), 71.7, 69.5 (O-CH-), 318, 29 .5, 29 .4, 29 .3, 29 .2, 29 .1, 29 .0, 25 .9, 22 .6 (-CH2-), 13.9 (-CH3) MS (ESI): m/z: 524 .5, 433.4, 355 .2, 26 5.1, 23 8.1, ... (C=O), 157.3, 156.7, 156 .2, 154 .2, 141.5, 134.8, 129 .1, 128 .2, 125 .2, 124 .8, 113.5 (ArC, C=C), 69.3 (O-CH-), 31.8, 29 .5, 29 .4, 29 .3, 29 .2, 29 .1, 28 .7, 27 .9, 25 .8, 22 .6 67 (-CH2-), 18.3 (=C-CH3), 13.9...
- 25
- 298
- 0
Synthesis and characterization of novel jacketed polymers and investigation of their self assembly and application
... enhanced in the selfassembly of the novel polymers 53 2.1.4 Conclusion A series of novel jacketed polymers were synthesized, and characterized using GPC, DSC, TGA, FTIR, NMR, and X-ray diffraction ... properties of jacketed polymers in which the main chain is sterically crowded with laterally attached rigid side chains17-19 Here we report the synthesis of a series of novel jacketed polymers ... interactions, and shape effects, to control the self- assembly of polymer chains in the lattice The novel polymers were characterized with GPC, DSC, TGA, FTIR, 35 and NMR This work show characterization...
- 24
- 324
- 0
Fabrication and characterization of semiconductor nanowires for thermoelectric application 4
... roughness of the nanowires and act as a form of phonon-scattering elements at several length scales If precipitates are incorporated carefully, the k of Ge Thermal Conductivity of GeNw and SiNw 77 nanowires ... resistivity of the GeNw were measured and extracted accordingly as below Electrode to 2, to and to : 0. 349 ! m Electrode to and to : 0 .41 3 ! m Electrode to : 0 .48 2 ! m Literature value for resistivity of ... before the GeNw sample becomes fully oxidized Figures 40 (a) and 40 (b) shows the SEM images of the GeNw sample that was annealed Thermal Conductivity of GeNw and SiNw 87 after 60 hours and 24...
- 21
- 192
- 0
synthesis and application of functionalized diene-based polymers(fileminimizer)
... substitution of poly(4-fluoro-2,5benzophenone) with various nucleophiles .7 1-4 Synthesis of functionalized polythiophenes 1-5 Synthesis of functionalized PLA and PCL 1-6 Synthesis ... 1-6 Synthesis of functional polyesters In the following chapters, the functionalized monomer approach is used to prepare functionalized diene-based materials Synthesis of a wide variety of functionalized ... Scheme 1-4 Synthesis of functionalized polythiophenes15 Nadeau et al reported the synthesis of functionalized poly(lactic acid)s (PLA) and poly(caprolactone)s (PCL) for biomedical applications...
- 184
- 332
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1) ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b...
- 12
- 588
- 0
Synthesis and Application of Nanosize Semiconductors for Photoxidation of Toxic Organic Chemicals pptx
... Adsorption of toxic chemicals in aqueous supernatant from Step 2)Chemical Oxidation or Total Mineralization of the the Organics 3)Deep UV Photooxidation of the Organics 4)Photocatalytic oxidation of ... in both dispersed and heterogeneous forms (supported) tsnl Advantanges of this Approach•The light absorption and energy levels of the semiconductor valence and conduction bands can be adjusted ... photostability and low toxicity can be selected (e.g MoS2) •Our synthesis allows easy chemical modification of the nanocluster surface properties (e.g deposition of a metal) •Small size of nanocluster...
- 22
- 961
- 0
synthesis and application of dna-templated silver nanowires
... of the adsorption sites gradually on the nanowires 3.2.2 Response and recovery of the DNA-templated silver nanowires exposed to ammonia The response and recovery of the DNA-templated silver nanowires ... carried out at room temperature Results and discussions 3.1 Fabrication of the DNA-templated silver nanowires The fabrication of DNA-templated silver nanowires was based on electroless plating, ... of DNA-templated silver nanowires, (b) shows enlargement of the DNA-Ag nanowires Fig Conductivity variation of the DNA-templated nanowires exposed to different concentrations of ammonia at room...
- 5
- 566
- 0
Báo cáo khóa học: Overexpression and enzymatic characterization of Neisseria gonorrhoeae penicillin-binding protein 4 ppt
... range of 4. 27.5 and the male urethra having a pH of 6.28 .4 The pH dependence of NG PBP (pKa values of 6.9 and 10.1) therefore overlaps the alkaline side of the physiological growth range of N gonorrhoeae ... and characterization of the ponA gene encoding penicillin-binding protein from Neisseria gonorrhoeae and Neisseria meningitidis J Bacteriol 179, 27832787 13 Spratt, B.G & Cromie, K.D (1988) Penicillin-binding ... MnCl2 MgCl2 100 1 04 96 103 89 45 85 89 76 81 106 91 56 59 95 1 04 105 109 1 04 115 102 100 99 47 1 04 99 107 103 92 89 99 100 101 100 100 99 100 99 24 92 97 93 99 98 101 1 04 103 97 1 04 102 102 97 105...
- 10
- 328
- 0
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx
... simulations on the divider can be performed The crystal oscillator is normally a commercially available part and data on its phase noise performance is often available from the manufacturer The ΣΔ ... measured and simulated phase noise for the 3.2-3.3 GHz band The square dots are the simulated data synthesizer phase noise performance The model can serve as a design guide for synthesizer designers ... University of Central Florida under a Motorola Research Grant on SAW device package electrical characterization and oscillator design From 1991 to 1995, he was a Staff and Lead Oscillator Design Engineer...
- 11
- 416
- 0
Nanoscale metal-organic frameworks synthesis and application of bimodal micromeso-structure and nanocrystals with controlled size and shape
... preparing bimodal micro- and meso-porous MOF nanocrystals, uniform nanosized MOFs with controlled- shape and size and subsequently, the extensive application of the prepared nanosized MOFs The first objective ... preparation of mesoporous MOF nanocrystals and uniform nanoscale MOFs with desired shape and size 1.2 Objectives of the thesis The aim of this thesis is to develop synthetic methods for preparing bimodal ... developed to achieve bimodal micro/mesoporous MOF nanocrystals as well as nanosized MOFs with controlled size and shape In addition, using the synthesized MOF nanocrystals as templates, a new hollow...
- 199
- 994
- 0
Expressed sequence tags analysis of major allergens producing dust mites and molecular characterization of their allergens
... www.pdffactory.com List of Tables IgE binding rates of the cloned dust mite allergens and their biological properties 22 Overview of the productions of recombinant mite allergens: from the aspects of the production ... mutants of the mites FABP homologues 70 Overview of the characteristics and statistical data of the dust mites EST collections 80 Summary and comparisons of gene expression levels in D farinae and ... House dust mites as an important cause of allergy 1.6.1 General aspects of mites Mites are normal inhabitants in our environment and are abundant in house dust as well as barns and grain stores Mites...
- 312
- 4,031
- 0
Từ khóa: studies on growth crystal structure and characterization of novel organic nicotinium trifluoroatesting and spectrometric characterization of polymerssynthesis solubilisation and characterization of cdse zns core shell qdsidentification detection and molecular characterization of novel monopartite begomovirusesidentification and characterization of der f 22 a novel allergen from dermatophagoides farinae a paralogue of der f 2synthesis and electrochemical performance of lifepo4 by solgel methodsynthesis and electrochemical performance of graphenepolyanilinesynthesis and electrochemical performance of graphenelike ws2nanoparticle an overview of preparation characterization and applicationecosystems and human wellbeing health synthesis a report of the millennium ecosystem assessmentisolation and characterization of vascular endothelial cells from murine heart and lungisolation and characterization of embryonic and adult epicardium and epicardium derived cells2measurement synthesis and materialization of manufacturing informationelectron energy loss spectroscopy and its applications to characterization of carbon materialselectrochemical characterization of carbons and carbon alloysBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ