0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic acid CK1 casein kinase CK2 casein kinase ... interacting proteins Using the former approach, the catalytic α subunit of protein kinase CK2 (formerly known as casein kinase 2) was isolated from rat brain extracts The direct associations of CK2 with...
  • 182
  • 480
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 2

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 2

... intracellular Ca2+-release To investigate the participation of mitochondria- specific CD38 in mediating Ca2+ release from ryanodine-sensitive Ca2+ stores, an in vitro assay was set up using intact mitochondria ... activity and specific topology of CD38 and its role in Ca2+-release assay observed from the data, this suggest that mitochondrial CD38 plays a role in cADPR synthesis and may participate in a ... with a mitochondrial targeting signal Further investigation of subcellular localization of expressed CD38 in mitochondria in parallel with the ADPribosyl cyclase assay had demonstrated localization...
  • 59
  • 280
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 3

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 3

... that CD38 staining is mainly associated on the outer membrane of mitochondria It is interesting to note that instead of a uniform distribution of the CD38 staining around the outer mitochondrial ... Expressed in Mitochondia from Murine Brain 4.2.4 Determination of the enzymatic activities of brain mitochondrial CD38 4.2.4.1 Determination of ADP-ribosyl cyclase activity of mitochondrial CD38 The ... intermembrane space and the inner mitochondrial membrane was analyzed to determine the integrity of the mitochondria OPA1, a protein of the intermembrane space, was protease resistant in mitochondria but...
  • 35
  • 174
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 4

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 4

... antibody-sc-7 049 A, B: intense CD38 immunostaining labeled the outer membrane of mitochondria (arrow), ER as well as plasmalemma (arrow head) Note the immunostained ER and mitochondria were in close ... bar: 1, 2µm 186 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain A B Figure 4. 14 CD38 immunoreactivity in the mouse cerebellum, labeled with goat polyclonal CD38 antibody-sc-7 049 ... immunopositive mitochondria located in Basket cell The enlargements of the encircled area of the basketcell are shown in the following page Blood vessel was heavily stained with CD38 antibody (arrow) Scale...
  • 3
  • 191
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 8

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 8

... Isolation and characterization of intact mitochondria from neonatal rat brain Brain Res Protocol 8: 176- 183 Nishina H, Inageda K, Takahashi K, Hoshino S, Ikeda K and Katada T (1994) Cell surface antigen ... organelles capable of generating and conveying electrical and calcium signals Cell 89 : 1145–1153, 1997 Ikehata F, Satoh J, Nata K, Tohgo A, Nakazawa T, Kato I, Kobayashi S, Akiyama T, Takasawa ... the functional role (s) of brain mitochondrial CD 38 A study of CD38KO mice (Jin et al., 2007) was conducted and showed that transmembrane CD 38 has an essential role in regulating the secretion of...
  • 45
  • 340
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 5

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 5

... immunostaing is restricted to surface of mitochondria (arrow) Scale bar: 0 .5 m 189 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain Gd Figure 4.17 CD38 immunoreactivity in ... of staining with CD38 involving the surface of the outer mitochondrial membrane facing the cytosolic side In contrast to the immunogold labeling of CD38 on the outer mitochondria membrane, all ... localization in mitochondria isolated from mouse brains, labeled with goat polyclonal CD38 antibody-sc-7049 AB, representative images of mitochondria isolated from mice brain stained with antiCD38 antibodies...
  • 6
  • 254
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria

... mobilization agents such as ix cADPR, ADPR and NAADP and thus may have a critical role in intracellular Ca2+ signalling x ABBREVIATIONS ADPR adenosine diphosphate ribose ATRA all-trans-retinoic acid BSA ... NUDT9-H domain (Kuhn et al., 2004; Perraud et al., 2005) These data revealed that ADPR and NAD+ act as intracellular messengers and may play an important role in Ca2+ influx by activating TRPM2 in immunocytes ... to human CD38 while a faint CD38 hybridizing band was detected in tomato DNA (refer to review by Ferrero and Malavasi, 1999) Analysis of the public sequence databases showed that proteins sharing...
  • 104
  • 231
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 6

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 6

... the surface of mitochondria 1 96 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain A B Figure 4.20 Backscatter electron micrographs of mitochondrial fractions, labeled ... varying size of mitochondria with dense cristae with varying shapes of round, tubular to spherical (Figure 4.20B) 195 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain Mitochondrial ... Scale bar: 1µm 197 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain A B Figure 4.21 Backscatter electron imaging (BEI) of mitochondrial fractions, labeled with goat...
  • 5
  • 223
  • 0
Subcellular compartmentalization of CD38 in non  hematopoietic cells  a study to characterize its functional role in mitochondria 7

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 7

... important to examine its precise localization on the organelle Mitochondria are compartmentalized into matrix, inner mitochondria membrane, intermembrane space and outer mitochondrial membrane, as discussed ... tend to argue against any artifactual rearrangement of the mitochondrial membranes during experimental manipulation All of the above considerations strongly suggest that the DAB stain accurately ... CD38 in the recent years The possibility that expressed intracellular CD38 has an important role in intracellular signaling and yet maintaining its membrane bound locality is important and cannot...
  • 17
  • 215
  • 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

... Polymerase (Invitrogen) and the primers: PDZ-1 -2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, ... ribosomal protein S6 kinase 2, a direct substrate of ERK, thereby enhancing the activation of this latter kinase [6] Human disc-large homolog (hDlg) is a member of the membrane-associated guanylate ... ERK cascade O Maıga et al ¨ Introduction The mitogen-activated protein kinases (MAPKs) are a family of S ⁄ T -protein kinases, including p38, c-Jun N-terminal kinase and extracellular signal-responsive...
  • 11
  • 419
  • 0
Identification of plant as a novel and alternative host model for burkholderia pseudomallei

Identification of plant as a novel and alternative host model for burkholderia pseudomallei

... Pseudomonas syringae and R solanacearum have been elucidated using Arabidopsis as a plant model (Quirino and Bent, 2003) 3.2 Materials and Methods 3.2.1 Plant Materials 3.2.1.1 Tomato and Arabidopsis ... and can be isolated from rice paddy fields in endemic areas such as Thailand Dharakul and Songsivilai first raised the question of a relationship between B pseudomallei and plants (Dharakul and ... Rice and Arabidopsis plantlets were also infected with B pseudomallei and B thailandensis to evaluate their potential as plant models for 48 disease Rice is chosen for evaluation as B pseudomallei...
  • 119
  • 420
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... Periplasmic NirF binds d1 heme S Bali et al NirF were fractionated and run on the SDS ⁄ PAGE for western analysis by using the alkaline phosphatase conjugate of strep-tactin antibody, we found that ... from Saccharomyces cerevisiae), we found that the two proteins had 24% sequence similarity A crystal structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important ... substrate for NirF that is translocated In either case the transport process is enigmatic as none of the Nir proteins codes for a transmembrane protein that could be a candidate for moving d1 heme, ...
  • 12
  • 613
  • 0
Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

... expressed and purified the homologous domain of CR (CR I II, residues 1 1 00) [23,32] This has allowed us to analyze the biochemical and structural properties of CR I– II and to compare them with Calb I II ... I II compared to Calb I II In contrast to Calb I II, CR I II shows no tendency to dimerize and both EF-hands of CR I II bind calcium We conclude that the significant structural and biochemical ... EF-hand of CR I II has a potential high calcium affinity The principal limited proteolysis products of CR I II conveniently correspond to individual EF-hand motifs (residues 1 6 0 and 61 1 00)...
  • 9
  • 648
  • 0
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

... examined for its gonadinhibiting function by using a RNA interference (RNAi) technique RNAi, a post-transcription gene-silencing process in which dsRNA triggers sequence-specific suppression of its cognate ... that of Mee-GIH expression in mature female M ensis [17] Interestingly, expression of Pem-GIH in 972 these tissues was found in both male and female of adult and adolescent P monodon (Fig 4) dsRNA-induced ... automated DNA sequencing The recombinant plasmid of hairpin -RNA of Pem-GIH was subsequently transformed into an RNaseIII-deficient E coli HT115 strain Expression of hairpin -RNA was induced with 0.4...
  • 11
  • 369
  • 0
Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

... theophylline The arrow points to the M-A2aTr316-H10 fusion protein Note that the main contamination, seen in lane 1, runs only marginally above the hA2aR fusion protein and is the main band in ... obtained, namely LysIle-Glu-Glu-Gly-Lys-Leu-Val-Ile-Trp corresponds to the N-terminus of the mature maltose-binding protein Binding of the fusion protein to the IMAC gel in buffer containing ... solubilization and puri®cation of a hA2aR fusion protein in quantity and quality suf®cient for biophysical characterization and crystallization The following points made the puri®cation of large amounts of...
  • 11
  • 582
  • 0

Xem thêm

Từ khóa: structure function and its possible role in the pathogenesis of myotonic dystrophy type 1the neutrophil and its special role in chronic obstructive pulmonary diseasegeneration and characterization of oligodendrocytes from lineage selectable embryonic stem cells in vitro pdfderivation and characterization of thyrocyte like cells from embryonic stem cells in vitro pdfcharacteristics of obesity and its related disorders in chinadenial of service dos attack and its possible solutions in vanetcarbon nanotubes as a novel electron material and their promise for technological applicationscharacterization of localised dry spots on creeping bentgrass turf in the united statesplanning macro economic control and government´s role in the perspective of economic crisisthe presence of ra and its molecular transducers in the developing cnsdiscovery of cyclophilin inhibitor nim811 as a novel therapeutic agent for hcvpolyphenol rich cocoa and chocolate potential role in the prevention of diabetesa new class of mesoscopic aggregates as a novel drug delivery systemcellular targets of e6 and their potential role in hmec immortalizationanti inflammatory effects of human cord blood and its potential implication in neurological disordersBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP