Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics
... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic a...
Ngày tải lên: 16/09/2015, 17:10
... intracellular Ca2+-release To investigate the participation of mitochondria- specific CD38 in mediating Ca2+ release from ryanodine-sensitive Ca2+ stores, an in vitro assay was set up using intact mitochondria ... activity and specific topology of CD38 and its role in Ca2+-release assay observed from the data, this suggest that mitochondrial CD38 plays a role in...
Ngày tải lên: 11/09/2015, 09:07
... that CD38 staining is mainly associated on the outer membrane of mitochondria It is interesting to note that instead of a uniform distribution of the CD38 staining around the outer mitochondrial ... Expressed in Mitochondia from Murine Brain 4.2.4 Determination of the enzymatic activities of brain mitochondrial CD38 4.2.4.1 Determination of ADP-ribosyl cyclase activi...
Ngày tải lên: 11/09/2015, 09:08
Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 4
... antibody-sc-7 049 A, B: intense CD38 immunostaining labeled the outer membrane of mitochondria (arrow), ER as well as plasmalemma (arrow head) Note the immunostained ER and mitochondria were in close ... bar: 1, 2µm 186 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain A B Figure 4. 14 CD38 immunoreactivity in the mouse cerebellum, labeled wi...
Ngày tải lên: 11/09/2015, 09:08
Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 8
... Isolation and characterization of intact mitochondria from neonatal rat brain Brain Res Protocol 8: 176- 183 Nishina H, Inageda K, Takahashi K, Hoshino S, Ikeda K and Katada T (1994) Cell surface antigen ... organelles capable of generating and conveying electrical and calcium signals Cell 89 : 1145–1153, 1997 Ikehata F, Satoh J, Nata K, Tohgo A, Nakazawa T, Kato I, Kobayashi S, Akiy...
Ngày tải lên: 11/09/2015, 09:08
Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 5
... immunostaing is restricted to surface of mitochondria (arrow) Scale bar: 0 .5 m 189 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain Gd Figure 4.17 CD38 immunoreactivity in ... of staining with CD38 involving the surface of the outer mitochondrial membrane facing the cytosolic side In contrast to the immunogold labeling of CD38 on the o...
Ngày tải lên: 11/09/2015, 09:08
Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria
... mobilization agents such as ix cADPR, ADPR and NAADP and thus may have a critical role in intracellular Ca2+ signalling x ABBREVIATIONS ADPR adenosine diphosphate ribose ATRA all-trans-retinoic acid BSA ... NUDT9-H domain (Kuhn et al., 2004; Perraud et al., 2005) These data revealed that ADPR and NAD+ act as intracellular messengers and may play an important role in Ca2+ influx by a...
Ngày tải lên: 11/09/2015, 09:08
Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 6
... the surface of mitochondria 1 96 Chapter Characterization of CD38 Expressed in Mitochondia from Murine Brain A B Figure 4.20 Backscatter electron micrographs of mitochondrial fractions, labeled ... varying size of mitochondria with dense cristae with varying shapes of round, tubular to spherical (Figure 4.20B) 195 Chapter Characterization of CD38 Expressed in Mito...
Ngày tải lên: 11/09/2015, 09:09
Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 7
... important to examine its precise localization on the organelle Mitochondria are compartmentalized into matrix, inner mitochondria membrane, intermembrane space and outer mitochondrial membrane, as discussed ... tend to argue against any artifactual rearrangement of the mitochondrial membranes during experimental manipulation All of the above considerations strongly suggest that...
Ngày tải lên: 11/09/2015, 09:09
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... Polymerase (Invitrogen) and the primers: PDZ-1 -2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, ... ribosomal protein S6 kinase 2, a direct substrate of ERK, thereby enhancing the activation of this latter kinase [6] Human disc-large homolog (hDlg) is a memb...
Ngày tải lên: 22/03/2014, 16:20
Identification of plant as a novel and alternative host model for burkholderia pseudomallei
... Pseudomonas syringae and R solanacearum have been elucidated using Arabidopsis as a plant model (Quirino and Bent, 2003) 3.2 Materials and Methods 3.2.1 Plant Materials 3.2.1.1 Tomato and Arabidopsis ... and can be isolated from rice paddy fields in endemic areas such as Thailand Dharakul and Songsivilai first raised the question of a relationship between B pseudo...
Ngày tải lên: 09/10/2015, 10:49
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... Periplasmic NirF binds d1 heme S Bali et al NirF were fractionated and run on the SDS ⁄ PAGE for western analysis by using the alkaline phosphatase conjugate of strep-tactin antibody, we found that ... from Saccharomyces cerevisiae), we found that the two proteins had 24% sequence similarity A crystal structure of Met8P has shown that this protein has an aspartate re...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf
... expressed and purified the homologous domain of CR (CR I II, residues 1 1 00) [23,32] This has allowed us to analyze the biochemical and structural properties of CR I– II and to compare them with Calb I II ... I II compared to Calb I II In contrast to Calb I II, CR I II shows no tendency to dimerize and both EF-hands of CR I II bind calcium We conclud...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx
... examined for its gonadinhibiting function by using a RNA interference (RNAi) technique RNAi, a post-transcription gene-silencing process in which dsRNA triggers sequence-specific suppression of its cognate ... that of Mee-GIH expression in mature female M ensis [17] Interestingly, expression of Pem-GIH in 972 these tissues was found in both male and female of ad...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc
... theophylline The arrow points to the M-A2aTr316-H10 fusion protein Note that the main contamination, seen in lane 1, runs only marginally above the hA2aR fusion protein and is the main band in ... obtained, namely LysIle-Glu-Glu-Gly-Lys-Leu-Val-Ile-Trp corresponds to the N-terminus of the mature maltose-binding protein Binding of the fusion protein to the IMAC gel...
Ngày tải lên: 24/03/2014, 00:21