0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Ohanin a novel protein from king cobra (ophiophagus hannah) venom 2

Ohanin   a novel protein from king cobra (ophiophagus hannah) venom 2

Ohanin a novel protein from king cobra (ophiophagus hannah) venom 2

... fragments can then associate to form an enzymatically active protein to cleave the chromogenic substrates This process is called as α-complementation Properly expressed β-galactosidase protein (after ... chemicals, adjust to pH 7.8 using glacial acetic acid and autoclave Dilute to 1X before use SOB medium (for preparation of competent cells) Tryptone Yeast extract NaCl KCl MgCl2.6H2O MgSO4.7H2O 20 .00 ... 0.19 g 2. 03 g 2. 46 g Prepare without Mg2+, adjust to pH 7.0 and autoclave A M stock of Mg2+ (1 M MgCl2 and MgSO4, filter stelize) is used to make the medium 20 mM in Mg2+ TB buffer (for preparation...
  • 7
  • 156
  • 0
Ohanin   a novel protein from king cobra (ophiophagus hannah) venom

Ohanin a novel protein from king cobra (ophiophagus hannah) venom

... S A N P E F L G * aagacatccagtctctgaagggacccccaccccccatccatggacattactggacatccc ctgcaatcatccagggccccaccggcgggacccccaacggtcaacaccccttttcaatat gtcccttcaaataaactcactagactgg SRTX -a1 SRTX-c SRTX-b SRTX-c ... N V gagccactttgctcctgtaaagacatgacggataaagagtgcctcaatttctgccatcag E P L C S C K D M T D K E C L N F C H Q gacgtcatctggaaaaatgcggacaccagcgccaatccagagttcctaggctagctagga D V I W K N A D T S A N P ... N V gagccactttgcacctgtaaagacatgacggataaagagtgcctctatttctgccatcag E P L C T C K D M T D K E C L Y F C H Q ggcatcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg G I I W R D T K Q A A R D...
  • 180
  • 230
  • 0
The study of the mediation of ohanin, a king cobra (ophiophagus hannah) toxin through the central nervous system

The study of the mediation of ohanin, a king cobra (ophiophagus hannah) toxin through the central nervous system

... Animalia kingdom, Chordata phylum, Vertebrata subphylum, the Reptilia class and Squamata order (Evans, 2003) Venomous Snakes There are many different and diverse species of animals across all phyla ... Cobras, coral snakes, kraits, mambas, sea snakes, sea kraits and Australian elapids Viperidae (viperids) True vipers and pit vipers, including rattlesnakes Table Snakes that known to cause dangerous ... Ophiophagus hannah – King Cobra The King Cobra (Ophiophagus hannah) is the world's longest venomous snake, with a length that can be as large as 5.6 m This species is found throughout South-Eastern...
  • 79
  • 276
  • 0
A novel protein from helicobacter pylori with a potential role in gastroduodenal diseases

A novel protein from helicobacter pylori with a potential role in gastroduodenal diseases

... aaactcaaaa gtttagggtt tttaaaacac cctttaaaaa cgatgcccta tattttagag ggcgggagca tagaaagcga tggggctggg agcgttttaa ccaacaccca atgcctgtta gaaaaaaatc gtaaccccca tttgaatcaa aatggaatag aaaacatgct taaaaaggaa ... ttaggggcta aacaggtgct ttggtattct tatggctatc tcaaaggcga tgataccgat agccataccg acacgctcgc tcgtttttta gataaagaca ccattgttta tagcacatgc gaggatgaaa acgatgagca ctacacagcc ttaaaaaaaa tgcaagaaga attaaaaacc ... attaaaaacc tttaaaaaac tagacggaac gccctataaa ctcatccccc tagaaatccc caaagccatt tttgatgaaa accaacaacg ctcgccggca acttatgtga attttttatt gtgcaataac gctctcatcg tgcccactta caacgaccct aaagacgcgc tcattttaga...
  • 103
  • 216
  • 0
A novel protein isolated from the venom of ophiophagus hannah (king cobra) showing beta blocker activity

A novel protein isolated from the venom of ophiophagus hannah (king cobra) showing beta blocker activity

... Lalitha Rajagopalan, my brothers Mr Prasanna and Mr Vasanth and my cousins Ms Aarthi Ravichandran and Ms Madhulika Ravichandran Nandhakishore Rajagopalan January, 2008 v TABLE OF CONTENTS Page ... and highly neurotoxic 1.1.2 Ophiophagus hannah This thesis deals with proteins isolated from the venom of Ophiophagus hannah (King cobra) This snake belongs to the family elapidae and it is the ... Elapidae is a diverse family of venomous snakes found in Americas, Asia, Africa and Australia (Figure 1.2 D) This family includes cobras, kraits, mambas, coral snakes and a large diversity of Australian...
  • 246
  • 357
  • 0
Beta cardiotoxin  a novel protein isolated from the venom of ophiophagus hannah (king cobra) showing beta blocker activity

Beta cardiotoxin a novel protein isolated from the venom of ophiophagus hannah (king cobra) showing beta blocker activity

... Lalitha Rajagopalan, my brothers Mr Prasanna and Mr Vasanth and my cousins Ms Aarthi Ravichandran and Ms Madhulika Ravichandran Nandhakishore Rajagopalan January, 2008 v TABLE OF CONTENTS Page ... and highly neurotoxic 1.1.2 Ophiophagus hannah This thesis deals with proteins isolated from the venom of Ophiophagus hannah (King cobra) This snake belongs to the family elapidae and it is the ... Elapidae is a diverse family of venomous snakes found in Americas, Asia, Africa and Australia (Figure 1.2 D) This family includes cobras, kraits, mambas, coral snakes and a large diversity of Australian...
  • 246
  • 321
  • 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

... tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex aeolicus; Tt, Thermoanaerobacter tengcongensis ... presence of unlabeled ATP, indicating that ATP and the analog 8-azido-ATP recognize the same binding site The ATPase activity of PfPDO was demonstrated The hydrolysis of ATP was linear for up to 30 at ... understanding of the function of these proteins in hyperthermophilic archaea and bacteria In fact, PfPDO is able to catalyse the oxidation of dithiols, as well as the reduction and rearrangement of...
  • 12
  • 506
  • 0
Báo cáo y học:

Báo cáo y học: " A novel protein-coding ORF72.2 gene was identified from Marek’s disease virus strain CVI988" pot

... Nakamura K, Tsukamoto K, Hihara H: Isolation of Marek’s disease virus from Japanese quail with lymphoproliferative disease Avian Pathol 1990, 19:119-129 10 Gunasekera RS, Damodaran H, Rajakarunanayake ... Taxonomy of Viruses Academic Press; 2005 Witter RL: Protection by attenuated and polyvalent vaccines against highly virulent strains of Marek’s disease virus Avian Pathol 1982, 11:49-62 Kawamura H, ... article as: Tian et al.: A novel protein-coding ORF72.2 gene was identified from Marek’s disease virus strain CVI988 Virology Journal 2010 7:371 Acknowledgements The research was supported by...
  • 5
  • 287
  • 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) ... of a small heat shock /a- crystallin protein (p26) in encysted embryos of the brine shrimp, Artemia franciscana Am Zool 39, 836–847 Liang, P & MacRae, T.H (1999) The synthesis of a small heat shock /a- crystallin...
  • 10
  • 495
  • 0
Báo cáo khoa học: A novel trehalase from Mycobacterium smegmatis ) purification, properties, requirements potx

Báo cáo khoa học: A novel trehalase from Mycobacterium smegmatis ) purification, properties, requirements potx

... S-300 Novel trehalase from Mycobacterium smegmatis Molecular mass standards included thyroglobulin (669 kDa), b-amylase (200 kDa), alcohol dehydrogenase (150 kDa) and BSA (66 kDa) SDS ⁄ PAGE was ... optima, from acidic trehalases with optima at 4.0–5.6 to neutral trehaA Novel trehalase from Mycobacterium smegmatis lases with pH optima of about 7, like the mycobacterial enzyme In a few cases, ... harvested and assayed for trehalase activity The transformant strain, M smegmatis p99 6A6 61, exhibited an acetamidedependent increase in trehalase activity as shown in Table 4, whereas the strain...
  • 14
  • 271
  • 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

... [8], the CS -a/ b motif [2] Alignment of Fig 2, using the CLUSTAL X program, shows a clear cut separation of all the b Na-ScTxs from all the a Na-ScTxs The a Na-ScTxs have identities of the order of ... Discussion NMR solution structure of Cn12 Figures 4, and summarize the most important data obtained from the NMR analysis of pure Cn12 It was possible to analyze the NMR data because of well-dispersed ... constraints were added to the calculations The dynamic annealing structure calculations were performed with the CNS software suite [44] Analysis of Na+-channel sequences By searching data banks...
  • 13
  • 434
  • 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

... 140), A9 0 is the absorption with the 90 polarizer, and S are order parameters calculated from the ratio of the parallel and perpendicular absorption bands SL is for the lipid chains, derived from ... Similar aggregates appeared only very faintly in the absence of lipids (Fig 4A) The rather long lag phase preceding fast hemolysis (Fig 1A) may also indicate that the formation of a functional ... 34 around the perpendicular to the plane of the membrane [23] We obtained an average angle of 45 However, considering that the average orientation shown by the lipid chains in the same spectra...
  • 12
  • 492
  • 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

... in Fig Within the nucleus, the protein again seemed to be localized to compartments in the interchromatin space (Fig 7) To further confirm the localization of ISP36, an inter4329 Interchromatin ... Peptidyl-prolyl-cis-trans isomerase B precursor Fragment of lamin A or C Lamin A Lamin C or lamin A fragment Fragment of lamin A or C Fragment of lamin A or C Fragment of lamin A or C ATP binding cassette, subfamily ... interchromosomal compartments and many kinds of speckles Therefore, searches for and analyses of novel nuclear structural proteins are necessary to gain further insight into the inner nuclear structure, nuclear...
  • 12
  • 400
  • 0
Báo cáo y học:

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining layer completely devoid of ... synovial lining layer and perivascular regions of RA (OCT section) tissue.(b) Intense staining of the synovial lining layer and perivascular regions of OA (paraffin section) tissue (c) An area demonstrating...
  • 9
  • 489
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...
  • 8
  • 426
  • 0

Xem thêm

Từ khóa: identi cation of a novel protein an examplemunteanu n 2008 important tools of setting in a novel available from lt http nina munteanu suite101 com important tools of setting in a novel 80471 ixzz1givodp00 gt 10 december 2011identification and characterization of der f 22 a novel allergen from dermatophagoides farinae a paralogue of der f 2a case study from river basin kosynthos in june 2011kiaa0725p a novel pla 1 with sequence homology to a mammalian sec23p interacting protein p125cloning sequencing and expression of a novel goose type lysozyme gene with chitinase ra chic activity from the moderately thermophilic bacterium ralstonia sp a 471a hub protein that relays signals from nutrients growth factors and various stressessafe home a novel approach to protect the home from aedes aegyptihypoxia inducible factors in acute kidney injury from pathophysiology to a novel approach of organ protectiona novel antimicrobial abietane type diterpene from salvia albocaeruleayou are going to read an extract from a novel for questions 1 8 choose correct answer a b c or d 2 ptsiguana dzip1 protein is a novel component of the ciliogenic pathway essential for axonemal biogenesis dev dyn 2010 feb 239 2 527 34dip a novel arabidopsis vird2 interacting proteinjr mcdonald wg waldon dj leone jw lull jm bannow ca lund et mathews wr 2004 identification of a novel mitochondrial protein quot mitoneet quot cross linked specifically by a thiazolidinedione photoprobe am j physiol endocrinol metab 286 e252 260hdmcp a novel liver specific uncoupling protein 127Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ