Reactive oxygen species mediated regulation of the na+ h+ exchanger, NHE 1 gene expression a new mechanism for tumor cells resistance to apoptotic cell death

... Nck [72] The binding of these proteins could prevent the interaction of the Ca2+ ⁄ CaM complex to the receptor if the CaMBD were occluded at least in part Nevertheless, the docking of these adaptor ... internalization and the subsequent degradation of the receptor in transfected human embryonic kidney cells [50] Direct regulation of the EGFR by CaM The direct regulation of the EGFR upon binding of the Ca2+ ... activation of the EGFR, where the C-terminal lobe of the kinase domain of one of the monomers forming the dimeric receptor interacts with the N-terminal lobe of the apposed monomer [19,47,84] Of relevance...

... Regulation of activity and expression of NHE 1 54  1. 4.4 A  1. 4.4 B  1. 5  Regulation of NHE -1 activity 54  Transcriptional regulation of NHE -1 expression .58  AIM OF STUDY 61 ... response repression of NHE -1 expression .11 1  Figure 13 : Thiol oxidizing agent diamide mimicked the effect of H2O2 in the downregulation of NHE -1 gene expression 11 3  Figure 14 : ME inhibited ... inhibition of NHE -1 gene expression by thiol-oxidant diamide 11 9  Figure 18 : Caspases and 10 are not activated by H2O2 in L 61. 1 cells 12 1  Figure 19 : H2O2 induced activation of caspases...

... MOLECULAR FUNCTION AND REGULATION OF THE BAX- ASSOCIATING PROTEIN MOAP- 1 Fu Nai Yang INSTITUTE OF MOLECULAR AND CELL BIOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2007 MOLECULAR FUNCTION AND REGULATION ... pore 35 1. 3.3.3 Channel formation 38 ii 1. 4 THE MULTIDOMAIN PRO-APOPTOTIC PROTEIN BAX AND BAK 41 1.4 .1 Bax plays dominant role over Bak 41 1.4.2 Regulation of Bax function 42 1. 5 REGULATION OF MITOCHONDIA-DEPENDENT ... apoptotic stimuli 11 4 3.2.8 MOAP- 1 is a key short-lived protein required for Bax function in mitochondria 11 7 3.2.9 Conclusions 12 0 3.2 .10 Acknowledgement 12 1 DISCUSSION 12 2 4 .1 MOAP- 1 IS A MITOCHONDRIAL...

... human and a murine NICN1 cDNA clone from the IMAGE collection and determined the complete sequences of these cDNAs The comparative analysis of the human, canine, and murine NICN1 cDNA revealed a ... CACCAGgtcagctgggcctca 423 418 bp (exon 3, 11 4 bp) … CCAAAGgcaagtgactttgca 4 01 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca 3 71 bp (exon 5, 10 5 bp) 600 … TTCGACgtgagtaacagtgtc 74 bp (exon 6, 14 31 bp) 20 31 … AATAAATACTTGTGGAATATG ... by the AMT gene for aminomethyltransferase, an enzyme of glycine metabolism [4 ,11 ] The promoters of the canine and murine NICN1 genes lack a TATA box-motif In both species, the sequences in the...

... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... Na -palmitoylation of Gas is regulated also remains unclear However, we assume that mammalian Gup1 competes with Skn for Shh to prevent palmitoylation rather than catalyzing depalmitoylation of ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon for...

... in contact with the end surfaces of the wires were obtained by annealing at 250 1C for 20 Using the Pd2Si contacts as source and drain and the silicon substrate as a back-gate, a transistor configuration ... configuration, contact geometry and charge distribution are demonstrated in Fig The preparation started from an SOI wafer with a silicon film thickness of 55 nm and a buried oxide layer (BOX) of 145 ... ¨m elementary point charges are placed on the surface of the wire to a concentration of  1012 cmÀ2 and mirrored in the metal The barrier lowering for this concentration at a distance of nm from...

... cholesterol in macrophages that transform into foam cells This effect is restored by the addition of prostaglandins AA, arachidonic acid; ABCA1, ATP-binding cassette transporter A1 ; COX, cyclooxygenase; ... Statistical analysis of experimental data Statistical analysis was performed using SigmaStat version 2.03 (SPSS Inc., Chicago, IL, USA) Data was analyzed using the Kruskal-Wallis one-way analysis ... Skelly MM, Stack WA, Gray D: Increased risk of myocardial infarction as first manifestation of ischaemic heart disease and nonselective nonsteroidal antiinflammatory drugs Br J Clin Pharmacol 2006,...

... indicate that LIS1 might directly inhibit PP2A and that the inhibition of PP2A is likely to be mediated by WD domain(s) of LIS1 Binding of Tat to LIS1 does not affect the inhibition of PP2A by LIS1 We ... activity, % 100 80 PP2A 60 PP1 40 20 Figure LIS1 inhibition of PP2A is not altered by Tat LIS1 inhibition of PP2A is not altered by Tat Phosphatase assay was performed as described in Methods PP2A ... Tat-induced HIV-1 transcription [21,22] Expression of the catalytic subunit of PP2A enhanced activation of HIV-1 promoter by phorbol myristate acetate (PMA), whereas inhibition of PP2A by okadaic...

... uncoupling of the Na+-NQR activity by dioxygen Characterization of redox cofactors in membranes from V alginolyticus In the presence of NADH and dioxygen, the purified Na+NQR from V alginolyticus ... the degree of uncoupling of the enzyme The term ÔuncouplingÕ describes the observation that the electrons derived from the oxidation of NADH by the Na+-NQR are not completely transferred to the ... alginolyticus membranes that impede the detection of the Fe–S cluster of the Na+-NQR in the membrane-bound state by EPR spectroscopy ACKNOWLEDGEMENTS This work was supported by a grant from the...

...