Development of new methodologies for the synthesis of enantiomerically enriched compounds

Development of new methodologies for the synthesis of enantiomerically enriched compounds

Development of new methodologies for the synthesis of enantiomerically enriched compounds

... DEVELOPMENT OF NEW METHODOLOGIES FOR THE SYNTHESIS OF ENANTIOMERICALLY ENRICHED COMPOUNDS LEE CHENG HSIA ANGELINE (B.ApplSc (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... alcohols, there are no reported illustrations for the synthesis of the cis-linear regioisomer Herein, an effective and unusual approach towards the synt...

Ngày tải lên: 16/09/2015, 08:30

223 272 0
Part   development of novel methods for the synthesis of homoallylic alcohols part II  multigrams synthesis of ( ) epibatidine

Part development of novel methods for the synthesis of homoallylic alcohols part II multigrams synthesis of ( ) epibatidine

... 25 25 25 Time (h) 2.0 5.0 6.0 1.5 5.0 2.0 Yield %b (1 03:10 4) (E/Z)c 25 (1 00: 0) (8 0/2 0) 23 (1 00: 0) (8 0/2 0) 25 (7 6:2 4) (8 0/2 0) 45 (1 00: 0) (8 0/2 0) 49 (1 00: 0) (8 0/2 0) 69 (1 00: 0) (8 0/2 0) 105 105a 105b ... Yield 9a (% ) ( : ) (E/Z) 15 (7 5:2 5) (1 00/ 0) 22 (2 3:7 7)...

Ngày tải lên: 16/09/2015, 17:11

211 497 0
Tài liệu Một số thuốc mới chống rối loạn lipid máu (New drugs for the control of dyslipidemia) pdf

Tài liệu Một số thuốc mới chống rối loạn lipid máu (New drugs for the control of dyslipidemia) pdf

... Cmax, giảm dao động hấp thụ thuốc ảnh hởng thức ăn tăng 25% sinh khả dụng Mong thông tin cập mang lại niềm vui cho bệnh nhân bị rối loạn lipid máu Tài liệu tham khảo Tài liệu khoa học công ty dợc ... đợc pha lipid thành mạch, vitamin E chống chọi với oxy hoá LDL chống tác hại gốc tự nội bào * Bình rợu cũ Fenofibrat (liphanthyl) từ lâu đợc dùng phổ biến để điều chỉnh ng...

Ngày tải lên: 26/02/2014, 03:20

4 761 4
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot

Báo cáo khoa học: New evidence for the role of calcium in the glycosidase reaction of GH43 arabinanases pot

... activity of BsArb43B Furthermore, to determine whether the role of the calcium is structural, thermal shift assays were performed to determine the Tm of the protein in the presence and absence of the ... Together, these results confirm that the atom in the cluster is calcium To determine whether the calcium ion has a specific role in the activity of...

Ngày tải lên: 15/03/2014, 23:20

13 568 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involve...

Ngày tải lên: 17/03/2014, 10:20

9 626 0
solvothermal reactions- an original route for the synthesis of novel materials

solvothermal reactions- an original route for the synthesis of novel materials

... synthesis of novel materials and the development of new processes Solvothermal synthesis of novel materials Roy has described the challenge for synthesizing new materials to specification [32] Hydro- and ... Conclusion Solvothermal reactions appear to be important for either the synthesis of novel materials, the preparation of nanostructured particl...

Ngày tải lên: 20/03/2014, 13:08

11 1,5K 0
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...

Ngày tải lên: 05/05/2014, 15:26

8 634 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...

Ngày tải lên: 06/05/2014, 08:55

12 705 0
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

... patterns of the ZnO sample synthesized at 120 ◦C for 17 h hydrothermal treatment Figure a b d e c f Fig SEM images of the time-dependent evolution in the formation of 3D flower-like ZnO synthesized ... of the formation process of the 3D flower-like ZnO Figure Fig (a) Bar graph illustration of the photocatalytic degradation of KGL using ZnO samples s...

Ngày tải lên: 06/05/2014, 13:26

26 551 0
Báo cáo hóa học: " HPV vaccine: an overview of immune response, clinical protection, and new approaches for the future" pdf

Báo cáo hóa học: " HPV vaccine: an overview of immune response, clinical protection, and new approaches for the future" pdf

... vaccine: an overview of immune response, clinical protection, and new approaches for the future Journal of Translational Medicine 2010 8:105 Submit your next manuscript to BioMed Central and take ... response and therefore, indicates that the HPV L1 capsid-specific antibody is not a suitable diagnostic test for HPV infection Other HPV antigens [E1, E2...

Ngày tải lên: 18/06/2014, 16:20

8 600 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

... current paradigm and a proposed alternative paradigm The current common paradigm is characterized by separate and distinct programs with little coordination or overlap The alternate paradigm emphasizes ... integration of TB and HIV care and treatment are highly encouraging while at the same time their examples highlight the technical, programmatic, staffing and s...

Ngày tải lên: 20/06/2014, 08:20

5 470 0
Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

... Surface area of the catalyst before and after use in the reaction was measured using surface area & pore size analyzer (NOVA 1000e, Quanta chrome Instruments) All the chemicals were used as-received ... [6], amines [7], and synthesis of azaheterocycles [8] are some of the synthetic applications of oximes They are also useful for selective a- activation [9] and are ext...

Ngày tải lên: 20/06/2014, 22:20

6 591 1
Báo cáo hóa học: " An alternative route for the synthesis of silicon nanowires via porous anodic alumina masks" potx

Báo cáo hóa học: " An alternative route for the synthesis of silicon nanowires via porous anodic alumina masks" potx

... dimensions These nanoparticles necessarily have a size smaller than the pores of the AAO mask and will be responsible for the constant dimensions of the synthesized nanowires Figure shows the surface of ... structure of the membrane and before the treatment conditions allow the nanowires growth As can be seen there, the catalyst can be observed as small particl...

Ngày tải lên: 21/06/2014, 01:20

7 472 0
Báo cáo hóa học: " Effect of ion implantation energy for the synthesis of Ge nanocrystals in SiN films with HfO2/SiO2 stack tunnel dielectrics for memory application" pot

Báo cáo hóa học: " Effect of ion implantation energy for the synthesis of Ge nanocrystals in SiN films with HfO2/SiO2 stack tunnel dielectrics for memory application" pot

... minimize the H content in the films Ion implantation in these stack layers were carried out with 7 4Ge+ ions using GeH4 gas source for the extraction of Ge The Ge+ ion implantation was carried out ... annealing condition The dependence of implantation energy for the formation and evolution of Ge- NCs in these stack structures were studied fu...

Ngày tải lên: 21/06/2014, 05:20

7 361 0
w