Development of non aqueous ethylcellulose gel for topical drug delivery

Development of non aqueous ethylcellulose gel for topical drug delivery

Development of non aqueous ethylcellulose gel for topical drug delivery

... development of a non- aqueous gel system intended for topical delivery of moisture-sensitive drugs Both the non- aqueous hydrophilic and lipophilic gel systems were formulated The hydrophilic gels ... Model drug 38 I-D3 Formulation of non- aqueous MH gel 40 I-D3.1 Solvents and gelling agents 42 iii Table of Contents I-D3.1.1 Non- aqueous hydrophilic gel s...

Ngày tải lên: 15/09/2015, 17:10

303 408 0
Báo cáo y học: "arly development of non-hodgkin lymphoma following initiation of newer class antiretroviral therapy among HIV-infected patients - implications for immune reconstitution" pps

Báo cáo y học: "arly development of non-hodgkin lymphoma following initiation of newer class antiretroviral therapy among HIV-infected patients - implications for immune reconstitution" pps

... markers of AIDS-related lymphoma J Clin Oncol 2010, 28:77 3-7 79 doi:10.1186/174 2-6 40 5-7 -4 4 Cite this article as: Huhn et al.: Early development of non-hodgkin lymphoma following initiation of newer class ... predictors of AIDS-related non-hodgkin lymphoma in the highly active antiretroviral therapy era J Acquir Immune Defic Syndr 2010, 54:7 8-8...

Ngày tải lên: 10/08/2014, 05:21

8 300 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the la...

Ngày tải lên: 05/09/2013, 09:38

7 720 0
Tài liệu DEVELOPMENT OF AN AUTOUMATIC DATA PROCESSING FOR TRIAXIAL COMPRESSION TEST pdf

Tài liệu DEVELOPMENT OF AN AUTOUMATIC DATA PROCESSING FOR TRIAXIAL COMPRESSION TEST pdf

... Triaxial Testing System, Advanced Triaxial Testing of Soil and Rock, American Society for Testing Materials - Special Technical Publication, ASTM STP 977, pp 82-94, (1988) [6] Miwa Koichi, Nanba ... Itsuo and Tsuneyoshi Akihiko, On the Real Time Processing System for Triaxial Compression Test of Soil, Bulletin of the Faculty of Agriculture, Kagoshima University, p.211-...

Ngày tải lên: 10/12/2013, 06:15

9 614 0
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx

... Ó FEBS 20 02 Photoactivatable CRF2 receptor antagonist (Eur J Biochem 26 9) 528 9 [21 ] and astressin [22 ], a conformationally constrained nonselective CRF peptide antagonist [ 12, 23], we were ... USA) was used to monitor radioactivity Photolysis of ATB-[His 12] Svg( 12) 40), and its radioactively labeled analog 125 I-labeled ATB-[His 12] Svg( 12) 40) Photolysis was performed a...

Ngày tải lên: 31/03/2014, 08:20

7 345 0
Báo cáo khoa học: "THE TEXTUAL DEVELOPMENT OF NON-STEREOTYPIC CONCEPTS" potx

Báo cáo khoa học: "THE TEXTUAL DEVELOPMENT OF NON-STEREOTYPIC CONCEPTS" potx

... constituted sequentially by means of state transitions which are the effect of the interpretation of the actual textual usage of a limited set of linguistic means This technique offers the possibility to ... mechanisms involved in terms of the textual function of linguistic means with respect to the different layers of the text representation In our model the units of th...

Ngày tải lên: 01/04/2014, 00:20

6 227 0
Báo cáo sinh học: " Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pdf

Báo cáo sinh học: " Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pdf

... RSV-A2 virus and stained with True Blue™ peroxidase substrate The image shows an example of plaque differentiation by automated counting Each "x" represents one plaque counted by the image analyzer ... agreement and equivalence between traditional manual and automated plaque counting methods for detection of RSV neutralizing antibody titers The 180 tests performed...

Ngày tải lên: 19/06/2014, 08:20

5 420 0
báo cáo hóa học:" Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pptx

báo cáo hóa học:" Development of an improved microneutralization assay for respiratory syncytial virus by automated plaque counting using imaging analysis" pptx

... presence and absence of complement and sorted the data by assay, method, and complement treatment The range and mean of the replicate tests are depicted in Fig The difference in the mean of 136 ... agreement and equivalence between traditional manual and automated plaque counting methods for detection of RSV neutralizing antibody titers The 180 tests performed in the presen...

Ngày tải lên: 20/06/2014, 04:20

5 322 0
Báo cáo hóa học: " A comparative study of non-covalent encapsulation methods for organic dyes into silica nanoparticles" pptx

Báo cáo hóa học: " A comparative study of non-covalent encapsulation methods for organic dyes into silica nanoparticles" pptx

... Cite this article as: Auger et al.: A comparative study of non-covalent encapsulation methods for organic dyes into silica nanoparticles Nanoscale Research Letters 2011 6:328 Submit your manuscript ... Senarath-Yapa MD, Phimphivong S, Coym JW, Wirth MJ, Aspinwall CA, Saavedra SS: Preparation and characterization of poly(lipid)-coated, fluorophore-doped silica nanop...

Ngày tải lên: 21/06/2014, 04:20

12 573 0
Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

Báo cáo khoa học: " Development of a neuro-fuzzy technique for automated parameter optimization of inverse treatment planning" doc

... Percentage Dose ( %) Figure DVH Comparison of ANFIS and manual planning for a prostate case DVH Comparison of ANFIS and manual planning for a prostate case rized overview of the differences of discrete ... overall planning time While this approach offers a more systematic method to find a suitable plan than sequential optimization with arbitrarily changed constraints, a...

Ngày tải lên: 09/08/2014, 10:20

16 511 0
Development of a liposomal nanodelivery system for nevirapine ppsx

Development of a liposomal nanodelivery system for nevirapine ppsx

... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...

Ngày tải lên: 10/08/2014, 05:21

9 359 0
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelof...

Ngày tải lên: 10/08/2014, 21:23

7 436 0
Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

... than descriptive form Templates are created specifically for a particular setting and can be filled in by the reporting physician Synoptic reports are of great value because they ensure that all ... enablers and barriers to the use and sustainability of clinical synoptic reports; and to provide any suggestions or recommendations for implementation and sustainability of the sy...

Ngày tải lên: 11/08/2014, 05:21

6 440 0
báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc

báo cáo khoa học: " Development of a synoptic MRI report for primary rectal cancer" doc

... important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and documentation of the MRI; as well as clear communication ... implemented for rectal cancer in North America [16] Aims The specific aims of this project are to develop a synoptic MRI report for primary rectal cancer, and...

Ngày tải lên: 11/08/2014, 16:20

6 351 0
w