Structural and functional analysis of critical proteins involved in mRNA decay

Structural and functional analysis of critical proteins involved in mRNA decay

Structural and functional analysis of critical proteins involved in mRNA decay

... STRUCTURAL AND FUNCTIONAL ANALYSIS OF CRITICAL PROTEINS INVOLVED IN mRNA DECAY CHENG ZHIHONG (B.Sc) Ease China University of Science and Technology A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR ... deadenylation, decapping and degradation of the mRNA body Three proteins, hUpf1, Dhh1 and Ski8 involved in eukaryotic mRNA decay were structurally and f...

Ngày tải lên: 14/09/2015, 22:22

191 313 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... to the cytosol Here we confirm and extend earlier studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction The interaction of Pex1p ... for the Pex1p Pex6p interaction and their functional role in peroxisome biogenesis Results The contribution of Pex1p and Pex6p to peroxisomal bioge...

Ngày tải lên: 07/03/2014, 16:20

12 584 0
Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx

... b5 strand) of D3 and F27/Y289 (b2 strand), L67/M324, V70/I327 and L72/L328 (all in b4 strand) of B The second cluster consists of P6/M267, L10/ L271 (both in a-helix), V18/C279 (b1 strand), L32/F293 ... solution structures of the UBL domain of hHR23A/B bound to a UIM peptide of S5a [99,119] could be used to model the complex of hHR23A/B and ataxin-3 Similarly, the comple...

Ngày tải lên: 30/03/2014, 15:20

16 526 0
Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx

Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx

... the C-terminal domain, the E coli Pta N-terminal domain is involved in stabilization of the hexameric native structure, in expression of the maximum catalytic activity, and in allosteric regulation ... Results Expression and purification of E coli Pta and truncated Ptas containing the C-terminal end By analysis of the protein domain architecture of E coli Pta...

Ngày tải lên: 06/03/2014, 11:20

10 507 0
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Fur...

Ngày tải lên: 16/03/2014, 06:20

14 546 0
Báo cáo y học: "Summary The claudin multigene family encodes tetraspan membrane proteins that are crucial structural and functional components of tight junctions, which have important roles in regulating para­ cellular" pdf

Báo cáo y học: "Summary The claudin multigene family encodes tetraspan membrane proteins that are crucial structural and functional components of tight junctions, which have important roles in regulating para­ cellular" pdf

... Claudin- 4 Claudin- 18a Claudin- 3 Claudin- 18b Claudin- 20 Claudin- 12 Claudin- 14 Claudin- 2 Claudin- 19b Claudin- 19a Claudin- 16 Claudin- 7 Claudin- 1 Claudin- 21 Claudin- 24 Claudin- 22 Claudin- 23 Figure A phylogenetic ... Nag and Morin: Genome Biology 2009, 10:235 235.4 Claudin- 10a Claudin- 8 Claudin- 17 Claudin- 5 ‘Classic’ claudins ‘Non-classic’ claudins Clau...

Ngày tải lên: 14/08/2014, 21:20

7 348 0
Cloning, characterisation and functional analysis of horseshoe crab c reactive proteins

Cloning, characterisation and functional analysis of horseshoe crab c reactive proteins

... 5’-AGAATTCCTGTGTGCATCATTCG-3’ CrCRP-2R 5’-AACAGCTCGAGGAACAGTGAAAAATTC-3’ CrCRP-1F 5’-CCGGATCCCTTAAATTTCCTCCGTCTA-3’ CrCRP-1R 5’-CTAATACGAATTCTAAGCACAGATT-3’ Purpose Forward primer for PCR/ cloning of ... 121 41 TTCTCCGTCATTCCCGCGACTAGTAATGGTGGGAACGTTACCTGATCTGCAAGAAATTAC S P S F P R L V M V G T L P D L Q E I T CrCRP-2F-2Æ CTTATGTTACTGGTTCAAAATTCATCGCTTAAAGGCCTCACTTCATATGTTTTCGTACGC L C Y...

Ngày tải lên: 03/10/2015, 20:57

129 467 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

... that MCPIP regulates the amount of IL-1b mRNA Involvement of PIN domain of MCPIP in the stability of IL-1b mRNA In order to find out whether the PIN domain in MCPIP is responsible for IL-1b mRNA ... interacting with MCPIP will clarify the dynamics and features of this protein Role of MCPIP in regulation of the endogenous IL-1b transcript level...

Ngày tải lên: 18/02/2014, 14:20

14 598 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...

Ngày tải lên: 18/02/2014, 16:20

12 657 0
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... loop, the first and last turns of helices E and F, and the C-terminus helices I and J In addition, there is a lysine-rich N- and C-terminus, in accordance with the basic isoelectric point of CagS ... as that of other members of this family Finally, when crystallized in the presence of Cu(II), the protein shows the presence of the ion coordinated in a...

Ngày tải lên: 06/03/2014, 00:21

9 496 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ ... investigated by site-directed mutagenesis of a- crystallin domain residues and molecular modeling of protein structure The p26 a...

Ngày tải lên: 07/03/2014, 12:20

15 516 0
Báo cáo Y học: Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases pot

Báo cáo Y học: Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases pot

... report on the isolation of four new monoterpene synthase cDNAs by random sequencing of a flavedo-derived cDNA library of C limon and their characterization by functional expression in Escherichia ... sabinene, a-terpinene (E )-b-ocimene, terpinolene, linalool and a-terpineol cDNA isolation and sequencing Random sequencing of a cDNA library made from mRNA isolate...

Ngày tải lên: 08/03/2014, 23:20

12 683 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...

Ngày tải lên: 16/03/2014, 00:20

9 491 0
Báo cáo khoa học: Structural and functional consequences of single amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase pdf

Báo cáo khoa học: Structural and functional consequences of single amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase pdf

... with the amino group and the N3 atom of the cytosine (Fig 1) This study uses site-directed mutagenesis to further explore the contribution of these amino acids interacting with the pyrimidine ring ... consisting of three domains, the CORE, the LID and the NMPbind [1] A characteristic of bacterial CMP kinases is an extension of the NMPbind domain by 40...

Ngày tải lên: 16/03/2014, 10:20

11 437 0
w