Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

... epidemiological and genetic studies Pancreatic adenocarcinoma is a disease that is associated with advancing age (12) It is rare before the age of 40, and culminates in a 40 fold increased risk by the age ... ( 20- 22) A molecular and pathological analysis of evolving pancreatic adenocarcinoma has revealed a characteristic pattern of genetic lesions The challenge now...

Ngày tải lên: 14/09/2015, 22:09

118 501 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...

Ngày tải lên: 17/03/2014, 03:20

8 465 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further inves...

Ngày tải lên: 20/02/2014, 02:21

8 584 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

... pattern of expression of a gene [34–39] To evaluate the relevance of the leader intron in cardosin expression, we deleted it from the 5¢-flanking region of the genes (Fig 8) The deletion of the cardosin ... region of the cardosin B gene (from ) 147 bp to + 238 bp) .The 529 bp of the promoter region of the cardosin A gene that is relevant for gene...

Ngày tải lên: 30/03/2014, 09:20

17 360 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc

... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...

Ngày tải lên: 12/08/2014, 03:20

25 292 0
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

... we have purified, cloned and characterized Cyn d 24 as a novel pathogenesis-related protein from BGP Additionally, the identification of Cyn d 24 has identified the involvement of a novel class of ... AGAD AADA.NA.VG D. D 113 Zea AYA.S A- QRQG LI GG FW AGAD.SASDA.GS.VS QY.DHDT.S 112 Nicotiana AYA.N S-Q.AA NL HGQ AE -GDFMTAAKA.EM.V QY.DHD 118 Cyn d 24 DQGKM...

Ngày tải lên: 07/03/2014, 12:20

10 665 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt

... the Materials and methods section and analysed by SDS/ Fig Immunodetection of CCT a- subunit in the cytoplasm of E focardii SDS/PAGE of an E focardii cytoplasmic fraction (20 lg, lane 1) and of ... two additional b-tubulin isotypes were identified in E focardii They are denoted as b-T3 and b-T4 Comparison of the primary structure of b-tubulin isotypes from...

Ngày tải lên: 23/03/2014, 21:20

7 501 0
báo cáo hóa học:" The psychological context of quality of life: a psychometric analysis of a novel idiographic measure of bladder cancer patients’ personal goals and concerns prior to surgery" pot

báo cáo hóa học:" The psychological context of quality of life: a psychometric analysis of a novel idiographic measure of bladder cancer patients’ personal goals and concerns prior to surgery" pot

... religious participation and affiliation, disease and treatment history, and co-morbidities Analysis Plan Our analysis included examination of patient characteristics and quality of life, thematic content ... measure of bladder cancer patients’ personal goals and concerns prior to surgery Health and Quality of Life Outcomes 2011 9:10 Submit your ne...

Ngày tải lên: 20/06/2014, 15:20

18 580 0
báo cáo khoa học: " Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments" ppt

báo cáo khoa học: " Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments" ppt

... BnWRKY65 BnWRKY35 BnWRKY27 BnWRKY22 BnWRKY29 BnWRKY21 BnWRKY39 BnWRKY74 BnWRKY15 BnWRKY7 BnWRKY17 BnWRKY11 BnWRKY18 BnWRKY40 BnWRKY72 BnWRKY36 BnWRKY42 BnWRKY6 BnWRKY31 BnWRKY1N BnWRKY20N BnWRKY4N ... BnWRKY24 BnWRKY56 BnWRKY75 BnWRKY45 BnWRKY8 BnWRKY28 BnWRKY50 BnWRKY51 BnWRKY10 BnWRKY4C BnWRKY3C BnWRKY25C BnWRKY44C BnWRKY20C BnWRKY33C BnWRKY2C BnWRKY26C BnWRKY34C BnWRKY32C BnWRKY1C BnWRKY69...

Ngày tải lên: 12/08/2014, 03:20

19 381 0
báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf

báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf

... and attachment of pea seeds to the replum in a pod of the def mutant pea The def mutant pea shows a swollen and thick funicle compared to the wild type Arrows indicate the AZ and ALZ in the wild ... growing of the plants, harvested materials, carried out the structural examination and drafted the manuscript YKL participated in designing t...

Ngày tải lên: 12/08/2014, 03:20

7 373 0
Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

... GTCCACATCAACGGCCGCCGGCTCG AGCCAACAGACACTCCTGTGTTCC CATGCCAGACCCTGATATTATCACC ACCTACACCAATGTCACCTGGAC GTGCCACACCTACTATGACCACAG TCAAGCCTCCAAACCAAGCC TGGCGGTCCATAAATGAGGTG TATGCAGCTTTGGCAATTCCC TTGATCTTTAGCAACTGTATCTG ... TGGTGGAGGCCTGTTCAGAGC CCAAGTTGTGGGCTGTCAACAC CAGAGTCCTCCTGGTGGACATTC ATTACCAAGCGCAACGCTAGGC CATGTGGCCAACATGTGTG TGATTTGGTCAAGGTAGCC CCTTCTACAACACCAAATGATTGCC AGGCCAGGATGTCAACAC...

Ngày tải lên: 12/08/2014, 04:21

10 401 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... heptose and the 4¢-phosphate by a galacturonic acid, is biologically, i.e agonistically as well as antagonistically, completely inactive The lack of antagonistic activity may be explained by the fact ... a CaF2 crystal and allowed to stand at room temperature until all free water was evaporated After this, IR spectra were recorded at room temperature and at 37 °C Usually, the or...

Ngày tải lên: 21/02/2014, 00:20

9 665 1
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

... examined in T ni [26] JHEH activity was very low at the beginning of the last larval stadium, but it gradually increased, reaching a peak at the wandering stage late in the last larval stadium At ... biotransformation, we first examined induction of EH activity by several chemicals in the larvae of a standard D melanogaster strain, Canton-S We found that exogenous chemicals a...

Ngày tải lên: 07/03/2014, 21:20

10 379 0
Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

... translating two proteins of 199 amino acids and 182 amino Fig Alternative splicing of the IL-18 gene in rainbow trout (A) An alternative mRNA splicing site is present in exon of the trout IL-18 ... exons and five introns The Fig Comparison of the genomic organization of IL-18 and IL-1b genes in human, rainbow trout and the predicted Fugu/tetraodon orga...

Ngày tải lên: 16/03/2014, 16:20

11 427 0
hydrothermal synthesis and crystal structure of a novel one - dimensional tritungstate

hydrothermal synthesis and crystal structure of a novel one - dimensional tritungstate

... contributions from 1-, 2- and 4y 4-coordinated oxo groups Each W6 O 20 unit consists of a pair of center -of- symmetry-related W3 O 10 trimers of edge-sharing WO6 octahedra as shown in Fig Adjacent 4y W6 ... organicrinorganic hybrid phases are obtained and structurally identified using the single crystal X-ray diffraction method Brief crystal data of one of the phas...

Ngày tải lên: 19/03/2014, 16:48

4 379 0
w