The role of kruppel like factors in embryonic stem cells

The role of kruppel like factors in embryonic stem cells

The role of kruppel like factors in embryonic stem cells

... transcripts zinc finger protein 42 zinc finger protein 143 zinc finger protein of the cerebellum XI Introduction CHAPTER I INTRODUCTION Introduction CHAPTER I INTRODUCTION Stem cells can be identified ... MEF feeders in the presence of serum The conditioned medium can support the normal growth of ES cells in the absence of feeders indicating that fibroblasts are pr...

Ngày tải lên: 14/09/2015, 14:07

165 490 0
Báo cáo y học: "The role of toll-like receptors in acute and chronic lung inflammation" pdf

Báo cáo y học: "The role of toll-like receptors in acute and chronic lung inflammation" pdf

... the cytoplasmic signaling machinery [5] MyD88 was initially identified as part of the interleukin (IL) -1R and IL-18R signalling pathways and was subsequently implicated in signalling by almost ... signaling In addition to TLRs, a variety of other PRRs including the cytoplasmic NLRs and RLRs play important roles in the induction of lung inflammation For example, the cytopl...

Ngày tải lên: 11/08/2014, 03:20

14 668 0
THE ROLE OF INTERFERON REGULATORY FACTORS IN REGULATING THE EXPRESSION OF NKG2D LIGANDS

THE ROLE OF INTERFERON REGULATORY FACTORS IN REGULATING THE EXPRESSION OF NKG2D LIGANDS

... damage signaling inducing the expression of NKG2D ligands, the underlying pathway that links the DDR to the upregulation of NKG2D ligands is not clear The importance of the NKG2D ligands in tumour ... replicationinhibiting agents induce the expression of the mouse NKG2D ligands of the Raet1 family and the induction of Raet1 is inhibited whe...

Ngày tải lên: 13/10/2015, 15:54

70 374 0
Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

... stable supply of knowledge and skills in high need areas Increase the size, diversity of skills and productivity of the labor force Dimensions of Social and Economic Value Regional public institutions ... business Best Practice Highlights Slippery Rock University Regional Learning Alliance – workforce development and training/collaborations with business and...

Ngày tải lên: 21/02/2014, 01:20

29 655 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

... observed in weaker binders Evaluation of the VH ⁄ VL interaction strength To evaluate the VH ⁄ VL interaction strength of these 36 clones, phages were used to infect a nonsuppressing strain, HB2151, ... strong VH ⁄ VL binder, to describe the relationship, and also to identify key residues in determining the interdomain interaction stren...

Ngày tải lên: 07/03/2014, 12:20

11 462 0
Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

... Claire Cardie, Vincent Ng, David Pierce, Chris Buckley Examining the role of statistical and linguistic knowledge sources in a general-knowledge que stion answering system In Proceedings of the 6th ... periments with Open-Domain Textual Question Answering In the Proceedings of the 18th International Conference on Computational Linguistics (COLING-2000), pages 292298, 2000 Fr...

Ngày tải lên: 08/03/2014, 05:20

8 508 0
Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

... 5.2.) Hypothesis 2: When the gift recipient s perception of prior attitude toward a brand is neutral and the giver -recipient relationship is strong, then the gift recipient s post -brand attitude ... level of recipient s perception of prior brand attitudes - Hypothesis 7a: The recipient s post brand attitude change is greater when receiving the...

Ngày tải lên: 14/03/2014, 14:20

10 482 0
The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College Attendance pdf

The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College Attendance pdf

... Sherraden, and Julia Stevens for comments CENTER FOR SOCIAL DEVELOPMENT WASHINGTON UNIVERSITY IN ST LOUIS i REDUCING WILT The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College ... Destin, 2009) Charles, Roscigno, and Torres (2007) is the only study of the seven to examine the relationship between parent school savings...

Ngày tải lên: 15/03/2014, 10:20

22 515 0
Báo cáo khoa học: The role of glucose 6-phosphate in mediating the effects of glucokinase overexpression on hepatic glucose metabolism pdf

Báo cáo khoa học: The role of glucose 6-phosphate in mediating the effects of glucokinase overexpression on hepatic glucose metabolism pdf

... glucokinase and hexokinase I in distinct pools [3,24], or by the involvement of mechanisms, additional to Glc6P, in mediating the effects of glucokinase overexpression As glucokinase binds to a dual-specificity ... [5,7] Conditions that cause dissociation of glucokinase from GKRP are associated with a parallel increase in the cell content of Glc6P, confirming...

Ngày tải lên: 16/03/2014, 14:20

11 504 0
Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

... (particularly the short ones) have all zeroes in them In other words, none of the bigrams from the training set appears in these reviews This suggests that the main problem with the bigram model ... and E Hovy 2004 Determining the sentiment of opinions In Proc of COLING, pages 1367–1373 M Koppel and J Schler 2005 Using neutral examples for learning polarity In...

Ngày tải lên: 17/03/2014, 04:20

8 489 0
Báo cáo khoa học: The role of cytochrome P450 monooxygenases in microbial fatty acid metabolism pdf

Báo cáo khoa học: The role of cytochrome P450 monooxygenases in microbial fatty acid metabolism pdf

... clear upregulation of an alkane-inducible cytochrome P450 (AJ273607) The role of P450 in microbial fatty acid metabolism during the first hours of incubation [22] According to amino acid similarity, ... compounds is inherently coupled to fatty acid degradation because the conversion of alkanes to fatty acids is The role of P450 in microbial...

Ngày tải lên: 22/03/2014, 16:21

16 565 0
The Role of Interest Rate Swaps in Corporate Finance doc

The Role of Interest Rate Swaps in Corporate Finance doc

... explains the basic mechanics of interest rate swaps and examines these rationales in more detail FUNDAMENTALS OF INTEREST RATE SWAPS The most common type of interest rate swap is the fixed/floating ... Fixed/Floating Swap The quoted price of an interest rate swap consists of two different interest rates In the case of a fixed/floating swap, the qu...

Ngày tải lên: 22/03/2014, 17:20

20 387 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

... bridging the A and G b-strands of the I27 protein during the main unfolding barrier.[39] To further validate this view and gain insight into the role of solvent hydrogen bonds in protein unfolding, ... separating b-strands In Figure B, we define the pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand...

Ngày tải lên: 22/03/2014, 18:20

12 554 0
The Role of Digital Identity Management in the Internet Economy doc

The Role of Digital Identity Management in the Internet Economy doc

... IdM is also a key factor in fostering the growth of the Internet economy Given the current state of the global economy, the need to maximise the potential of the Internet economy assumes added significance ... benefits of its use, including across domains to deliver joined-up services over the Internet The scope of the Primer is limited to the man...

Ngày tải lên: 23/03/2014, 23:21

22 503 0
w