Functional study of zebrafish udu and its relationship to the notch signaling pathway

... between the Notch and p53 pathway During mammalian neural development, activation of the Notch signaling pathway is known to be involved in the maintenance of neural progenitor identity and the suppression ... Hence, the aim of this study is to investigate what causes the up-regulation of p53 and to further characterize other developmental defects t...

Ngày tải lên: 14/09/2015, 14:03

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên: 07/03/2014, 16:20

... and Christy’s previous publication (73), 117 4.4 Surface Plasmon Polariton Assisted Surface Enhanced Raman Scattering on Ultrasmooth Metal Surface The theory for an enhanced field near a metal ... distance of the center of the cavity to the surface is h The major and minor axis of the cavity are denoted ˆ as a and b respectively a y -axis is poi...

Ngày tải lên: 14/09/2015, 14:01

... Theory of Enhanced Raman Scattering and its Experimental Verifications 2 .1 General Theory of Raman Scattering 13 2.2 Enhanced Raman Scattering 13 2.2 .1 Chemical Raman Enhancement 14 2.2.2 Electromagnetic ... Schematic diagram of SNOM system for phase measurements 17 0 17 1 Fig 15 A typical AFM and SNOM mappings of a 10 0-nm nano- cavity substrate wi...

Ngày tải lên: 14/09/2015, 14:02

... B3 Ap32# Ar10 Figure A linkage map for the B-genome of Arachis A linkage map for the B-genome of Arachis Linkage map of Arachis based on an F2 population resultant from the cross A ipaënsis × A ... LG of the AA map, B6 with A6 and A1 0, and B7 with A7 and A8 Synteny analysis A total of 51 common markers mapped in the AA and...

Ngày tải lên: 12/08/2014, 03:20

... x25 ON THE PETERSON HIT PROBLEM OF FIVE VARIABLES Proof Let x be an admissible monomial of degree 15 in P5 and ω(x) = (3, 4, 1) From the proof of Lemma 3.5, x is a permutation of one of the monomials ... = The theorem is proved ON THE PETERSON HIT PROBLEM OF FIVE VARIABLES 11 Proof of Theorem 1.3 First of all, we briefy recall the definiti...

Ngày tải lên: 16/10/2015, 09:25

... present status of the river water quality in Hadano basin and its relation with nonpoint sources of pollution Up to now, river water quality had been monitored only at the downstream of rivers This ... 9, No.2, 2011 of this city This study on the analysis of river water quality and its relationship with nonpoint sources of pollution...

Ngày tải lên: 05/09/2013, 10:17

... Indirect-HMM-based Hypothesis Alignment for Combining Outputs from Machine Translation Systems In Proceeding of EMNLP Hawaii, US, Oct F Huang and K Papinent 2007 Hierarchical System Combination for Machine Translation ... word alignments are ready, we start from the intersection of the two word alignments, and then continuously add new links between backbone and h...

Ngày tải lên: 17/03/2014, 01:20

... statistically analyse interannual and seasonal variation of litterfall in a cork oak forest of the Montseny massif (Catalonia, north-eastern Iberian Peninsula) and its relationship with meteorological ... for meteorological and litterfall variables oak forests and Mediterranean oaks from relatively productive areas (Tab IV) Usually these areas are far from the coas...

Ngày tải lên: 07/08/2014, 16:20

... ripening-associated patterns for aromatic and branched chain amino acid-, fatty acid-, and furanrelated classes, with a peak at the S3/Br stages and a more or less pronounced decline at later ripening ... The data set was made up of data from eight repetitions of each ripening stage of RH and RHB The variable set was made of the major 41 volatile aroma compounds PCA invo...

Ngày tải lên: 11/08/2014, 11:21

... evidence supports a role for APC in maintaining the integrity of the endothelium through both direct and indirect mechanisms APC can potentially limit the elaboration of proinflammatory cytokines, ... neuroprotection, independent of its anticoagulant activity Activated protein C and endothelial barrier protection Another direct mechanism of action of APC on...

Ngày tải lên: 13/08/2014, 03:20

... favor in order to keep regulators from interfering in their operations 180 History of the Eighties—Lessons for the Future Chapter The Savings and Loan Crisis and Its Relationship to Banking with ... Future Chapter The Savings and Loan Crisis and Its Relationship to Banking partly to the fact that members of both political parties were vulnerab...

Ngày tải lên: 06/03/2014, 10:20

... case of the more general principle of flux minimization It has to be noted, furthermore, that minimization of fluxes in a metabolic system is closely linked to minimization of enzyme levels, because ... protein, protein interactions, enzymes, metabolites) can be used to build up mathematical models of the gene-regulatory, signal-transducing and metabolic network...

Ngày tải lên: 07/03/2014, 15:20

... bound of the types of the frames being unified, (2) update one frame's type to the least upper bound, and point the other's type representation to it, and (3) recurse on respective pairs of feature ... variables to various substructures of a TFS, , and then pass those variables outside the substructures of where they can be used to instantiate the value of another...

Ngày tải lên: 08/03/2014, 07:20