Functional interactions of protein tyrosine phosphatase alpha (PTPa) and src in mouse development and integrin singaling investigation of double PTPa src deficient mice and cells

Functional interactions of protein tyrosine phosphatase alpha (PTPa) and src in mouse development and integrin singaling  investigation of double PTPa src deficient mice and cells

Functional interactions of protein tyrosine phosphatase alpha (PTPa) and src in mouse development and integrin singaling investigation of double PTPa src deficient mice and cells

... Functional Interactions of Protein Tyrosine Phosphatase Alpha (PTPα) and Src in Mouse Development and Integrin Signaling: Investigation of Double PTPα /Src- Deficient Mice and Cells CHEN MIN ... integrin signaling, and plays a negative feedback role in orchestrating integrin signaling To determine how PTPα is regulated upon integrin stimulat...

Ngày tải lên: 14/09/2015, 12:02

215 341 0
Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx

Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx

... al Effect of ionic strength and oxidation on PhyAsr A A R258 R258 C252 OCS 252 B B R258 R258 OCS252 C252 Fig (A) Conformation of the P-loop at low ionic strength in the absence of ligand The P-loop ... Structure of PhyAsr under low and high ionic strength conditions To examine the structural effect of ionic strength on the P-loop, X...

Ngày tải lên: 18/02/2014, 18:20

10 597 0
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

... the membrane-distal domain of RPTPa affected the biological function of RPTPa, impairing Src binding and its ability to activate Src Our results indicate that a catalytically active D2 domain is ... that the catalytic activity of RPTPa-D2 plays an important role in Src activation To confirm that the catalytic activity of RPTPa-D2 is required for Src bindin...

Ngày tải lên: 15/03/2014, 10:20

9 289 0
Báo cáo khoa học: Calpain-mediated degradation of reversibly oxidized protein-tyrosine phosphatase 1B docx

Báo cáo khoa học: Calpain-mediated degradation of reversibly oxidized protein-tyrosine phosphatase 1B docx

... (àM) 10 30 A Phosphatase activity (% of untreated) Calpain-mediated degradation of reversibly oxidized protein-tyrosine phosphatase 1B 2830 kDa fragments Reversibly oxidized PTP1B IB: anti oxPTP ... Trumpler et al ă Calpain-mediated degradation of reversibly oxidized protein-tyrosine phosphatase 1B A B Fig Oxidation enhances binding of PTP1B to calpai...

Ngày tải lên: 16/03/2014, 00:20

12 299 0
Báo cáo khoa học: Weak oligomerization of low-molecular-weight protein tyrosine phosphatase is conserved from mammals to bacteria pot

Báo cáo khoa học: Weak oligomerization of low-molecular-weight protein tyrosine phosphatase is conserved from mammals to bacteria pot

... useful discussions This work was partially supported by funds from the Spanish Ministry of Education (BIO2007-63458 to MP) J.B is a recipient of a predoctoral fellowship from the Spanish Ministerio ... such as bacterial stress resistance Conserved weak protein interactions in lmwPTP Comparison of lmwPTPs from phylogenetically distant species (endogenous prokaryotic and e...

Ngày tải lên: 16/03/2014, 02:20

12 252 0
Báo cáo y học: " Characterization of protein tyrosine phosphatase H1 knockout mice in animal models of local and systemic inflammation" docx

Báo cáo y học: " Characterization of protein tyrosine phosphatase H1 knockout mice in animal models of local and systemic inflammation" docx

... processing of other cytokines and cytokine receptors [32-35] Interestingly, PTPH1 is known to inhibit TACE expression and activity in vitro [36] We therefore analyzed cytokines plasma levels in carrageenan-treated ... Clin Pathol 2008, 129:735-743 doi: 10.1186/1476-9255-7-16 Cite this article as: Patrignani et al., Characterization of protein tyrosine phosphatase H1 kno...

Ngày tải lên: 11/08/2014, 03:20

14 371 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine wh...

Ngày tải lên: 19/02/2014, 05:20

14 670 0
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt

Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt

... natural transformation of T thermophilus HB27 Furthermore, we present the first information on the subcellular localization of the PilMNOWQ and PilA4 competence proteins and on the effect of mutations ... in pilQ led to the absence of PilW and PilA4 in the inner membrane In addition, pilW mutation resulted in the absence of PilQ and PilA...

Ngày tải lên: 07/03/2014, 12:20

12 702 0
Báo cáo khoa học: The protein tyrosine phosphatase PTP-Basophil/Basophil-like Interacting proteins and molecular functions doc

Báo cáo khoa học: The protein tyrosine phosphatase PTP-Basophil/Basophil-like Interacting proteins and molecular functions doc

... bona fide tyrosine phosphatase [15,22] Currently, several proteins are known to serve as substrate for the protein tyrosine phosphatase domain of PTP-Bas/BL Theses proteins are RIL, IjBa and ephrinB, ... role in the assembly of supramolecular protein complexes [21] Finally, the protein tyrosine phosphatase domain is located at the extreme C-terminus of the mol...

Ngày tải lên: 30/03/2014, 20:20

10 426 0
Báo cáo y học: "Rheumatoid arthritis seropositive for the rheumatoid factor is linked to the protein tyrosine phosphatase nonreceptor 22-620W allele" docx

Báo cáo y học: "Rheumatoid arthritis seropositive for the rheumatoid factor is linked to the protein tyrosine phosphatase nonreceptor 22-620W allele" docx

... Arthritis Research & Therapy Vol No Dieudé et al systemic lupus erythematosus and with autoimmune thyroid disease [12-19] The PTPN22 gene encodes for the intracellular tyrosine phosphatase LYP, ... seronegative for rheumatoid factor Transmission, percentage of heterozygous 1858C/T parents transmitting the 1858T allele The plan was to test the hypothesis for RF+ RA;...

Ngày tải lên: 09/08/2014, 07:20

8 342 0
Organometallic scaffolds as protein tyrosine phosphatase 1b inhibitor

Organometallic scaffolds as protein tyrosine phosphatase 1b inhibitor

... 1.1 Protein Tyrosine Phosphatase 1B as drug target 1.2 Organic inhibitors of Protein Tyrosine Phosphatases 1.3 Metal complexes as inhibitors of Protein Tyrosine Phosphatases ... problems, there has been an intensified search for new therapeutic treatments for T2DM and obesity 1.1 Protein Tyrosine Phosphatase 1B as drug target Protein tyrosine phosphatases (PT...

Ngày tải lên: 02/10/2015, 17:14

84 165 0
Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

... system may be one of the mechanisms responsible for drug -induced apoptosis in a variety of JNK activation is critical for AG1478 -induced apoptosis cancer cells of different histotype [51] Chang ... RA & Davis RJ (2000) Requirement of JNK for stress -induced activation of the cytochrome c-mediated death pathway Science 288, 870–874 JNK activation is...

Ngày tải lên: 18/02/2014, 13:20

11 659 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotid...

Ngày tải lên: 18/02/2014, 06:20

15 624 0
w