Functional characterization of isthmin, a novel secreted protein in angiogenesis

Functional characterization of isthmin, a novel secreted protein in angiogenesis

Functional characterization of isthmin, a novel secreted protein in angiogenesis

... proteins, protein kinases and phosphatases Actin binding proteins that localize at FA sites include talin, tensin, paxillin, vinculin and α-actinin (Yam, et al., 2009) The assembly of FAs can be induced ... and adaptor proteins in focal adhesion complexes There are 25    four main signaling pathways activated by integrins that are relevant to angiogenesis: Ras-mitogen-activated protei...

Ngày tải lên: 14/09/2015, 08:25

259 462 0
Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

... β-cardiotoxin, an all β-sheet protein isolated from the venom of Ophiophagus hannah (king cobra) Manuscript under preparation xvi (5) Roy A, Sivaraman J, and Kini RM Structural and functional characterization ... forests and mangrove swamps in parts of Southeast Asia, South China and India Chapter One A B C Figure 1.1: Ophiophagus hannah (king cobra)...

Ngày tải lên: 10/09/2015, 08:37

308 442 0
Structural and functional studies of VP9, a novel nonstructural protein from white spot syndrome virus

Structural and functional studies of VP9, a novel nonstructural protein from white spot syndrome virus

... Dr Asha, Dr Huang Canhua, Dr Wu Jinlu, Ms Tang Xuhua, Ms Sunita and, Mr Jobi and the rest of the lab mates for the valuable discussion and friendship and the present and former members of Functional ... Birnaviridae, Bunyaviridae, Herpesviridae, Piconaviridae, Parvoviridae, Reoviridae, Rhabdoviridae, Togaviridae, Iridoviridae, Nodaviridae and Nimaviridae Crustacean viral dise...

Ngày tải lên: 14/09/2015, 09:57

148 397 0
Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc

... within negatively stained particles of artemin indicated the lack of metal storage capacity Function of an Artemia ferritin homolog A B C Artemin, apoferritin and ferritin inhibit citrate synthase ... denaturation Artemin, apoferritin and ferritin protected citrate synthase against denaturation at 43 °C in a concentrationdependent manner (Fig 3A C) Maximal protec...

Ngày tải lên: 16/03/2014, 11:20

9 434 0
Báo cáo y học: " Roles of XB130, a novel adaptor protein, in cancer" pps

Báo cáo y học: " Roles of XB130, a novel adaptor protein, in cancer" pps

... from Uehara Memorial Foundation and International Society of Heart and Lung Transplantation (AS) Lists of abbreviations AFAP: actin filament associated protein; AFAP1L2: actin filament associated ... understanding of these mechanisms Binding Partner pY PI3K Src inactive XB130 pY pY Binding Partner active tyrosine kinase-mediated signaling transcriptional activation Cell cycle Survival M...

Ngày tải lên: 10/08/2014, 09:22

5 340 0
Characterization of TROM, a novel transcription repressor in human cancers identified by modified suppression subtractive hybidization (MSSH)

Characterization of TROM, a novel transcription repressor in human cancers identified by modified suppression subtractive hybidization (MSSH)

... presented and discuss in Chapter Section Introduction Figure 1.3 a T7 promoter TAATACGACTCACTATAGGGAGA SP6 promoter ATTTAGGTGACACTATAGAAGNG T3 promoter AATTAACCCTCACTAAAGGGAGA b Figure 1.3 Paradigm of ... 2000;165(2):1153-9 52 Ohminami H, Yasukawa M, Kaneko S, Yakushijin Y, Abe Y, Kasahara Y, et al Fas-independent and nonapoptotic cytotoxicity mediated by a human CD4(+) Tcell clon...

Ngày tải lên: 12/09/2015, 09:59

181 247 0
Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor

Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor

... STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF TRX16, A THIOREDOXIN-LIKE PROTEIN AND ALTERING SUBSTRATE SPECIFICITY OF SPI1, A PROTEASE INHIBITOR PANKAJ KUMAR GIRI A THESIS SUBMITTED ... Farré and Casado, 2001; Laroux et al., 2001), atherosclerosis and other cardiovascular disorders, inflammation and chronic inflammation (Laroux et al., 2001; Latha and...

Ngày tải lên: 09/09/2015, 18:55

145 254 0
Isolation and characterization of aurora a kinase interacting protein (AKIP), a novel negative regulator for aurora a kinase

Isolation and characterization of aurora a kinase interacting protein (AKIP), a novel negative regulator for aurora a kinase

... Hypothesis of Possible Anti-Tumour Role of AKIP-mediated UbIndependent Degradation of Aurora- A, 234 ix Abbrevations aa A Box AD ADH AIK1 AKIP ALLM ALLN AML Amp APC/C ATP AURKA AZ AZI amino acid Aurora ... yeast and successfully isolated a novel negative regulator of Aurora- A kinase, named as AKIP (Aurora- A Kinase Interacting Protein) AKIP is an ubiquitous...

Ngày tải lên: 14/09/2015, 22:15

330 347 0
Functional studies of BPGAP1, a novel BCH domain containing RhoGAP protein

Functional studies of BPGAP1, a novel BCH domain containing RhoGAP protein

... and ARAP3 (Krugmann et al., 2002; Miura et al., 2002) All these three ARAP contain five PH domains, an ArfGAP domain and a RhoGAP domain (Miura et al., 2002) ARAP1 and ARAP3 have equal GAP activity ... Sekimata et al., 1999) PSGAP, a protein that interacts with PYK2 and FAD and contains multiple domains including a pleckstrin homology (PH) domain, a RhoGAP- activating prote...

Ngày tải lên: 17/09/2015, 17:20

196 243 0
Báo cáo khoa học: Purification and characterization of three isoforms of chrysophsin, a novel antimicrobial peptide in the gills of the red sea bream, Chrysophrys major doc

Báo cáo khoa học: Purification and characterization of three isoforms of chrysophsin, a novel antimicrobial peptide in the gills of the red sea bream, Chrysophrys major doc

... lamellae and EGC-like cells of the primary lamellae of red sea bream gills We are currently trying to obtain cDNAs encoding chrysophsins from the gills of red sea bream, and we aim to investigate the ... (minimal lethal concentration) of native and synthetic chrysophsins compared with that of magainin-2 Minimal lethal concentrations of peptide are given...

Ngày tải lên: 23/03/2014, 20:22

12 482 0
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢ b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢ c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and ... Ovarya Peripheral blood leukocytea Prostatea Small intestinea Spleena Testisa Thymusa Bone marrowa Fetal livera Lymph nodea Tonsila Breastb Lungb Milk cellsa Bovine Mammary glandc Mammary glan...

Ngày tải lên: 24/03/2014, 04:21

9 614 0
báo cáo khoa học: " Functional characterization of Arabidopsis thaliana transthyretin-like protein" potx

báo cáo khoa học: " Functional characterization of Arabidopsis thaliana transthyretin-like protein" potx

... et al.: Functional characterization of Arabidopsis thaliana transthyretin-like protein BMC Plant Biology 2010 10:30 Submit your next manuscript to BioMed Central and take full advantage of: • Convenient ... hydrolysis of 5-hydroxyisourate, the end product of the uricase reaction FEBS Lett 2005, 579:4769-4774 Page 10 of 10 15 Siegel L, Monty K: Determination of molecular w...

Ngày tải lên: 12/08/2014, 03:21

10 211 0
Functional analysis of syp1, a novel substrate of the serine threonine kinase prk1

Functional analysis of syp1, a novel substrate of the serine threonine kinase prk1

... 40 The homologous domains with Syp1p through searching against database - 89 x Abbreviations a. a or aa amino acid AAK1 adaptor-associated kinase ADF actin depolymerizing factor ADFH actin ... FUNCTIONAL ANALYSIS OF SYP1, A NOVEL SUBSTRATE OF THE SERINE/ THREONINE KINASE PRK1 QIU WENJIE A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY INSTITUTE...

Ngày tải lên: 14/09/2015, 11:59

152 332 0
Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

... designated P2Y12 [15–17] Results from our laboratory revealed that both classic P2Y1 and P2Y12 receptors coexist in glioma C6 cells: P2Y1, linked to phospholipase C, and P2Y12 , inhibiting adenylate ... and P2Y1 and P2Y12 receptor protein expression and functional activity Examination of the effects of specific pharmacological agents (a single agonist a...

Ngày tải lên: 30/03/2014, 08:20

13 378 0
Functional characterization of RNA editing and alternative splicing in the carboxyl terminus of cav 1 3 calcium channel

Functional characterization of RNA editing and alternative splicing in the carboxyl terminus of cav 1 3 calcium channel

... diversifies the function of calcium channels 1. 4 .1 Mechanism of alternative splicing 1. 4.2 Effects of alternative splicing in L-type calcium channels 1. 4 .3 CaV1 .3 in the brain is alternatively spliced 17 ... Deaminase Acting on RNA (ADAR) 1. 3. 2 Mechanism of RNA editing 1. 3. 3 Substrates of RNA editing 1. 3. 4 Role in neurophysio...

Ngày tải lên: 10/09/2015, 15:48

174 400 0
w