breaking out of bedlam a novel

Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

... 61. Marone PA, Yasmin T, Gupta RC, et al: Safety and toxicological evaluation of AlgaeCal (AC), a novel plant-based calcium sup- plement. Toxicol Mech Methods. 2010; 20:334-344. 62. Kaats GR: ... Kaats GR was the principal investigator; he se- cured and audited all study data, conducted all of the statistical analyses, and contributed significantly to the preparation and submission of ... known as „AlgaeCal‟ or „AC‟) made by milling whole, live-harvested sea algae found on the South American coastline. In addition to calcium, the algae contained other naturally occurring minerals...

Ngày tải lên: 25/10/2012, 11:10

12 664 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

... Length of fol- low-up was at least 3 years with a maximum of 6 years. Location of facet pain was cervical in 45, tho- racic in 15, and lumbar in 114 patients. Surgical times varied based on ... durable for at least 3 years. Larger scale trials with a control group are warranted to further evaluate the relative efficacy of this surgical treatment in patients with facet joint disease. ... Primary outcome measure was percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit. Secondary outcome was change in OSWESTRY disability index...

Ngày tải lên: 26/10/2012, 09:32

4 600 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... polymerase chain reaction. Med Sci Monit. 2001; 7: 345-9. 14. Ogawa Y, Itoh H, Nakagawa O, et al. Characterization of the 5'-flanking region and chromosomal assignment of the human brain natriuretic ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig. 1A) . The PCR ... in the Japanese. Circ Res. 2000; 86: 841-5. 13. Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K. Isolation of the 5'-flanking region of genes by thermal asymmet- ric interlaced polymerase...

Ngày tải lên: 26/10/2012, 10:04

7 612 1
A novel interval method for validating state enclosures of the

A novel interval method for validating state enclosures of the

... parameters is 1 Further information about ValEncIA-IVP as well as free software are available at http://www.valencia-ivp.com. 6 of the error bounds  R (κ+1) (t)  . Note that neither separate ... For VALENCIA-IVP, a MATLAB implementation using INTLAB 5.2 [19], [20] as well as a prototypical C++ implementation using PROFIL/ BIAS [21] and FADBAD [22] are compared. Reducing the step-size as ... paper, VALENCIA-IVP has been introduced as a novel approach for validation of state enclosures for initial value problems with both uncertain initial conditions and tolerances in the system parameters. Although...

Ngày tải lên: 12/01/2014, 22:04

12 373 0
How to get out of the friendzone: turn your  friendship into a  relationship

How to get out of the friendzone: turn your friendship into a relationship

... he met Cara at his coed dodgeball tournament. She was pretty and nice and seemed to like him back. They started dating and things were going well. At a party soon after Sam and Cara started seeing ... seeing each other, Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it. After hearing about ... would assume they are on a date. Why else would a guy see a community theater production of Man of La Mancha ? Sarah wonders if Matt considers these practice dates for when he meets a real girl....

Ngày tải lên: 10/02/2014, 18:17

240 1,1K 1
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal- ysis to amino acid-based chiral pharmaceuticals - exam- ples and perspectives. J Mol Catal B-Enzym 5, 1–11. 14 Liljeblad A & Kanerva LT ... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate was determined...

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain Thirumaran Thanabalu 1,2 , Rajamuthiah Rajmohan 2 , Lei Meng 2 , Gang Ren 4,5 , Parimala R. ... polyclonal GFP-spe- cific antiserum was a gift from J. Kahana and P. Silver (Dana Farber Cancer Center, Boston, MA). The anti-actin mAb was MAB1501 from Chemicon International (Teme- cula, CA). The anti-hexokinase ... vrp1D::KanMx bar1) [23], IDY166 (MATa his3 leu2 ura3 trp1 las17D::URA3 ) [20], and PJ69- 4A (MATa his3 leu2 ura3 trp1 gal4D gal80D met2::GAL7-lacZ GAL2-ADE2 LYS2::GAL1–HIS3) [64]. Yeast strain PJ69-4A...

Ngày tải lên: 18/02/2014, 16:20

23 680 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... 5¢-CGCGGATCC ACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢- CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ ... 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64- C, 5¢-CGCGGATCCGACTCAGTGGATGACCAATCC-3¢ and 5¢-CGCCTCGAGCTAAGAAGACTGGGCTGCC AG-3¢) that had 5¢ adapters corresponding to BamHI (GGATCC) ... 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... 5¢-AAGTAGGCGGAGTATCGAAC-3¢ (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense). Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ (antisense). Caspase 3 activity Cells ... intensity was determined using imagemaster 2d elite software 4.01 (Amersham Bioscience, Uppsala, Sweden). Statistical analysis Data in bar graphs are expressed as the mean and standard deviation of three ... Scotto-Lavino E, Du G & Frohman MA (2006) 3¢ End cDNA amplification using classic RACE. Nat Protoc 1, 2742–2745. 29 Szpaderska AM & Frankfater A (2001) An intracellular form of cathepsin...

Ngày tải lên: 18/02/2014, 18:20

12 613 0
Tài liệu Báo cáo khoa học: A novel tachykinin-related peptide receptor of Octopus vulgaris – evolutionary aspects of invertebrate tachykinin and tachykinin-related peptide ppt

Tài liệu Báo cáo khoa học: A novel tachykinin-related peptide receptor of Octopus vulgaris – evolutionary aspects of invertebrate tachykinin and tachykinin-related peptide ppt

... tachykinins: a review. Zool Sci 5, 533–549. 7 Satake H, Ogasawara M, Kawada T, Masuda K, Aoy- ama M, Minakata H, Chiba T, Metoki H, Satou Y & Satoh N (2004) Tachykinin and tachykinin receptor of an ascidian, ... vulgaris). Biochem J 387, 85–91. 25 Kanda A, Takahashi T, Satake H & Minakata H (2006) Molecular and functional characterization of a novel gonadotropin-releasing-hormone receptor isolated ... salivary vasodilator of the yel- low fever mosquito, Aedes aegypti. Insect Mol Biol 8, 459–467. 10 Kanda A, Iwakoshi-Ukena E, Takuwa-Kuroda K & Minakata H (2003) Isolation and characterization...

Ngày tải lên: 19/02/2014, 00:20

11 595 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... primers: gatggatcccatATGGGTG TTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCTTACGC annealing just before the putative transmembrane domain (capital letter ... Soave C & De Michelis MI (2002) A novel interaction partner for the C-termi- nus of Arabidopsis thaliana plasma membrane H + -ATP- ase (AHA1 isoform): site and mechanism of action on H + -ATPase ... H + -ATPase activity was evaluated as the difference between total activ- ity and that measured in the presence of 100 lm vanadate (less than 10% of total activity at pH 7; less than 5% of total activity...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... of parasites as potential targets for antiparasitic drugs. The African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating disease ... truncated fragments of TbPDE1 were also amplified using the same protocol and pET-PDE1 as template. PDE1(Arg189–Thr620) was amplified using the primer pairs 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
w