Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 5

... the nuage site Indeed, a recent study has suggested that TUD aids in the association of piRNAs with AUB and AGO3 in an arginine methylationdependent manner (Nishida et al., 2009) The nuage components, ... silencing of LINEs/nonLTRs among the examined nuage components therefore implies a common role in maintaining the silenced state of the heterochromatic retroeleme...

Ngày tải lên: 14/09/2015, 08:25

... of processing body (P-body) that are known to participate in mRNA degradation and translational silencing, Decapping Protein 1a (DCP 1a) and Glycine-tryptophan protein of 18 2kDa (GW182), are also ... et al., 2005b), and that the C elegans homologue of GW182, Acyl-CoA carboxylase insensitive (AIN -1) , interacts with a putative AGO family protein, Asparagine-linked glycosylation...

Ngày tải lên: 14/09/2015, 08:25

... gtcccacaccaacggcggag taatacgactcactataggg aattaaccctcactaaaggg catacgatttaggtgacactatatag cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta atgtcgaagatcggaattaac ttagtccttgctctgcatatactt ... caggattgataagaatgcaggacaaaa ttgcaatatgttaatgttaccagtccatg actttgctggtggaggtacggagacagagtaaattctgt t cataatactccacgcgcaaa cgtcttttggcttcttctcc attgccctcaaatcaagcag gtggacggaggagaagacaa tcattgacgatacc...

Ngày tải lên: 14/09/2015, 08:25

... magenta, and cyan, respectively Although krimp was identified as a highly expressed mRNA in the GSCs from the microarray analysis, immunostaining of KRIMP indicates a wide expression in germline ... melanogaster germline cells (a) KRIMP localises to the perinuclear regions of the germline cells in the Drosophila ovary Ovaries were immunostained with anti-KRI...

Ngày tải lên: 14/09/2015, 08:25

... vas, aub, cuff, and mael mutants In all of the examined mutants except mael, KRIMP perinuclear localisation was affected, while the localisation of AGO3 and MAEL appeared to depend on KRIMP, as ... It was also noticeable that VAS localisation depends partially on proper AUB localisation Although VAS foci were apparent in aub mutant, cytoplasmic VAS was visibly more abundant than...

Ngày tải lên: 14/09/2015, 08:25

... that consist of nuage cytoplasmic foci docking partially around the mRNA degradation components Overlapping nuage/P-body foci are expressed as percentages of the total number of overlapping and ... non-overlapping P-body foci The range of overlaps (complete or partial) appears to be independent of the foci sizes and nuage/P-body pairs (b) Immunostaining of overlapping cyto...

Ngày tải lên: 14/09/2015, 08:25

... that deadenylation is unaffected in at least one of the piRNA pathway mutant aub Figure 3.3 .7 Deadenylation is unaffected in aub mutant LM-PAT assay of cycB In the piRNA pathway mutant aub, deadenylation ... deadenylation appears unaffected since the poly (A) tail length is comparable to that of the control In contrast, deadenylation is impaired in the deadenylase...

Ngày tải lên: 14/09/2015, 08:25

... unaffected in the mRNA degradation mutants PAGE-northern analyses of piRNA production in the mRNA degradation mutants The level of piRNA production is unaffected in the mRNA degradation mutants ... 3’-UTR, and poly (A) All examined regions are derepressed in dcp1 and ski3 mutants (b) Quantitative RACE-PAT and RT-PCR of HeT -A mRNA, normalised against act5C, in dcp1 an...

Ngày tải lên: 14/09/2015, 08:25

... overlapped with the tER and endosomal markers (Figure 3.4.1) This is consistent with the observation by Lee et al (20 09) that AGO1 and AGO2 are associated with membranes in the cytoplasm in RNAi-defective ... tER/endosomal markers TER94, CD63, LAMP2, and ARF6 (green) In the wild-type ovary, KRIMP, PCM, and TER94/CD63/LAMP2/ARF6 overlap In the piRNA pathway mutants spn-E and...

Ngày tải lên: 14/09/2015, 08:25

... eye and salivary glands of D melanogaster (Pal-Bhadra et al., 2004) A preliminary finding in our laboratory has indicated the presence of VAS, KRIMP, and MAEL transcripts in the wild-type adult ... Cavalli, and V .A Gvozdev 2004 Dissection of a natural RNA silencing process in the Drosophila melanogaster germline Mol Cell Biol a2 4:6742-6750 Aravin, A. A., M L...

Ngày tải lên: 14/09/2015, 08:25

... tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table Comparison between exon structures in Xenopus ... 2002 Functional analysis of Xenopus MGP gene promoter (Eur J Biochem 269) 1949 GGAAAC-3Â) for amplication of the region from )783 to +33, and (5Â-CCGGAGCTCGAGGG...

Ngày tải lên: 08/03/2014, 10:20

... activity of DEC1 is also required for the interaction with BMAL1 Binding of DEC1 mutants to a CACGTG E-box To examine the binding ability of DEC1 mutants to the CACGTG E-box in the Dec1 promoter, ... for DEC1 suppressive activity against CLOCK/BMAL1-induced transcription In addition, the N-terminal region of DEC1, including the bHLH domain, interacted with...

Ngày tải lên: 19/02/2014, 16:20

... to the cytosol Here we confirm and extend earlier studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction The interaction of Pex1p ... for the Pex1p Pex6p interaction and their functional role in peroxisome biogenesis Results The contribution of Pex1p and Pex6p to peroxisomal bioge...

Ngày tải lên: 07/03/2014, 16:20

... and catalytic properties of the mutants, and simulations of the substrate–enzyme interactions of the wild-type and one of the mutants The results provide indications of the native enzymes’ catalytic ... construction of the mutant b-glucosidases Findings that cytokinin-O-glucosides are natural substrates for both of the two b-glucosidases, Zm-p60.1 and Bgl4:1, b...

Ngày tải lên: 16/03/2014, 04:20

... like the Trp residue of the 183 Conformation, ligand binding and distribution of nematode protein Ag-NPA-1 R Jordanova et al Fig Immunohistological localization of Ag-NPA-1 in adult A galli and ... ligand binding and distribution of nematode protein Ag-NPA-1 Fig Immunogold electron microscopic localization of Ag-NPA-1 in a male A galli worm (A) Sect...

Ngày tải lên: 16/03/2014, 18:20