Regulation of mitotic spindle biogenesis in budding yeast
Regulation of mitotic spindle biogenesis in budding yeast
... the formation of a bipolar mitotic spindle Hence, understanding the regulation of mitotic spindle biogenesis, the subject of this dissertation, is crucial for gaining insights into the chromosome ... Chapter1 Introduction All spindles are bipolar, but the structure of the spindle pole differs in different organisms The spindle pole is pivotal to the biogenesis of the mitotic spindle In mammalian ... C-terminus of ubiquitin, forming a covalent thioester bond between the terminal glycine of ubiquitin (Gly76) with a cysteine in the active-site of E1 In the second step, an ubiquitin-conjugating...
- 176
- 297
- 0
Báo cáo y học: " High-resolution transcription atlas of the mitotic cell cycle in budding yeast" pptx
... transcript is mainly contained within the protein-coding message; of these cycle inphase, and display opposite-phase expression For of 24 SAPs in which only the antisense transcript cycles, the antisense ... collected every minutes for 200 minutes (equal to three cell cycles) The degree of synchrony was monitored by assessing the number of budding cells Nuclear position was Page of 11 determined by Hoechst ... phase-specific splicing; hence, in contrast to meiosis in budding and fission yeast [49,50], we see no evidence for a regulatory role of splicing in the mitotic cell cycle of budding yeast Conclusions...
- 11
- 489
- 0
Regulation of spindle behaviour by DNA replication and damage checkpoints in budding yeast
... Phase and G2/M Checkpoints: In the budding yeast, DNA damage surveillance mechanisms operate in G1, S and G2 phases These are the G1 DNA damage checkpoint, the S phase replication and DNA damage checkpoints, ... REGULATION OF SPINDLE BEHAVIOR BY DNA REPLICATION AND DAMAGE CHECKPOINTS IN BUDDING YEAST SAURABH RAJENDRA NIRANTAR (B.Tech.(Hons), Indian Institute of Technology, Kharagpur) ... Segregation of Damaged Chromosomes in DNA- damaged Cells 122 4.3 Negative Regulation of Microtubule Associated Proteins Cin8 and Kip1 by DNA Damage Checkpoint 130 iv 4.4 Role of Cdh1 in Regulation...
- 247
- 273
- 0
Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt
... analysis of Lsm1 p showing the importance of residues proposed to be involved in RNA binding and complex formation, and of the C-terminal region for the func- Lsm1 and -8 domains involved in localization ... N- and ⁄ or C-terminal domains, exchanged the central Sm domains or, in the case of Lsm8 p, made point mutations in putative RNA-binding residues We investigated the cellular localization of GFPtagged ... in 5–20% of cells under stress conditions (Fig 5B), suggesting that the N-terminal domain of Lsm1 p is sufficient in combination with the Sm and C-terminal domains of Lsm8 p (i.e presumably in the...
- 16
- 515
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects telomere capping and whether ... order to validate the microarray data, we used quantitative RT-PCR to examine the expression of five of the up-regulated genes in a set of RNA samples that had been used in the array analysis (Figure...
- 17
- 432
- 0
Mechanism of protein quality control in the cytosol in budding yeast
... conserved cytosolic quality control pathways remains to be discovered The objective of this thesis is to get a better understanding of protein quality control in cytosol and further understand the mechanism ... al., 1998) The binding induces several factors; one of them being ubiquitin expression indicating its role in the regulation of the degradation system Under normal conditions, in the cytosol, HSF1 ... but it also assist in the folding of proteins through one or several ATPase cycle of binding and release and also promote the disaggregation of proteins with the help of another chaperone family...
- 165
- 377
- 0
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx
... endocannabinoid system, we investigated the presence and regulation of endocannabinoids, cannabinoid receptors and FAAH in immature and mature dendritic cells obtained by stimulation with either the ... min), two fractions were obtained: a top leukocyte band containing mononuclear cells (monocytes and lymphocytes) and a lower band containing polymorphonuclear leukocytes (granulocytes) and the ... abundant band in human immature dendritic cells was the one at 83 kDa which may be related to a predominant glycosylation form of the CB1 receptor in these cells Additionally, in the rat brain lysate...
- 8
- 645
- 0
Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx
... in protein protein interaction are blue and the dehydrogenase domains of Tic3 2 and Tic6 2 are shown in green Tic1 10 contains two transmembrane domains at the proximal N-terminus The topology of ... surprising to find proteins with redox-active domains as Tic constituents Up to now, the ‘regulon’ of the Tic complex comprises three proteins: Tic6 2, Tic3 2 and Tic5 5 The former two proteins belong ... and the two bona fide dehydrogenases Tic3 2 and Tic6 2 at the Tic complex holds the intriguing possibility of a Fig Schematic model of the proposed regulatory signals sensed by the Tic complex and...
- 11
- 491
- 0
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc
... Primers (Table 1) for pig glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (p7 and p8), E-selectin (p9 and Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur J Biochem ... transfected into cultured cells In view of the relatively low efficiency of transfection of primary endothelial cells, these experiments were performed using the established cell line PEC-A [25] Construct ... not change the activity, which Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur J Biochem 269) 1469 A A Size in kb Hinc II EcoR I Sty I Sty I Hinc II Eco R I 113 A.1...
- 10
- 444
- 0
Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf
... hemopexin-like domain (C domain) of human gelatinase A (matrix metalloproteinase- 2) requires Ca2+ for fibronectin and heparin binding Binding properties of recombinant gelatinase A C domain to ... autocatalytic step of the activation by binding to the 64 kDa intermediate form of MMP-2 [52] Binding and activation of MMP-2 was abrogated in the presence of avb3 integrin-binding macromolecules ... (2005) Dissecting the role of matrix metalloproteinases (MMP) and integrin alpha(v)beta3 in angiogenesis in vitro: absence of hemopexin C domain bioactivity, but membrane-Type 1-MMP and alpha(v)beta3...
- 18
- 463
- 0
Báo cáo Y học: Rum1, an inhibitor of cyclin-dependent kinase in fission yeast, is negatively regulated by mitogen-activated protein kinase-mediated phosphorylation at Ser and Thr residues pptx
... function of p25rum1 in the cell cycle may be regulated mainly by ubiquitination-based control of protein levels initiated by Cdc2–Cig1-mediated Thr5 8 /Thr6 2 phosphorylation However, Thr1 3 /Ser1 9 phosphorylation ... domain of the protein while the N-terminal portion is a regulatory domain mediating a reduction in activity upon phosphorylation of Thr1 3 /Ser1 9 by MAPK At this moment, the precise mechanism of ... GST fusion proteins of the DN74 mutant were similarly examined as in (A) ated phosphorylation sites in p25rum1 by generating aminoacid point mutants of wild-type in which each Ser and Thr residue...
- 11
- 520
- 0
Báo cáo Y học: Regulation of peptide-chain elongation in mammalian cells pptx
... ADP-ribosylated by diphtheria toxin [25] ADP-ribosylation inhibits the activity of eEF2 Phosphorylation of eEF2 inhibits its activity, in translocation and in poly(U)-directed polyphenylalanine synthesis ... existence of multiple forms of eEF2 kinase in phaeochromocytoma cells and the regulatory properties of eEF2 kinase in ventricular cardiomyocytes suggest the existence of a distinct form in these cells ... that phosphorylation of eEF1A/B and of valyltRNA synthetase by PKC increases their activities in translation elongation and amino acylation, respectively The increased activity of eEF1A/B appears...
- 9
- 469
- 0
Report on the Regulation of Reproductive Cell Donation in the European Union potx
... out the findings on the principles of confidentiality, anonymity and non-remuneration in the donation of reproductive cells, as well as donor compensation, consent for egg cell donations and the ... donor offers the cells exclusively for the use of the recipient specified in the declaration of donation; c) the declaration of donation includes – beyond the provisions set forth in Subsection ... only prior to the first harvesting of reproductive cells, if the donations of reproductive cells are made repeatedly, on an ongoing basis The ongoing nature of the donations does not exempt the...
- 21
- 302
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... expressing the recombinant mPC1 ⁄ 3, the presence of the 87 kDa form in excess of the 66 ⁄ 71 kDa facilitates isolation of the enzyme and helps in maintaining the enzymatic activity at a proper ... Bernard N, Kitabgi P & Rovere-Jovene C (20 03) The Arg617–Arg618 cleavage site in the C-terminal domain of PC1 plays a major role in the processing and targeting of the enzyme within the regulated ... previously, there exist instances whereby peptides located at the N- and the C-termini can negatively or positively cooperate in the activation of an enzyme In the case of proPC1 ⁄ 3, removal of the various...
- 10
- 305
- 0
Từ khóa: dominant role of the kidney in long term regulation of arterial pressure and in hypertension the integrated systubiquitin mediated regulation of human signaling networks in normal and cancer cells6 non epigenetic and epigenetic regulation of interleukin 1b expression in vitrobcgin dna induces up regulation of cd44hi cd62llo expression in pulmonary t lymphocytesthe regulation of cdx1 expression in the intestinal metaplasia is poorly understoodregulation of multi level marketing companies in indiachromium roles in the regulation of lean body mass and body weightestrogen s role in the regulation of appetite and body fatregulation of cortisol and epinephrine concentrations in plasma chapter 2 provides an overview of developments in the regulation of financial reporting by smes in the uk since the 1980sthe role of nkt cells in the immune regulation of neoplastic diseasecyclic nucleotide regulation of globin genes in erythropoiesisrole of sa in the regulation of cadmium toxicity in maize zea mays linteraction of hereditary and epigenetic mechanisms in the regulation of gene expressionp21waf1 cip1 and rb e2f pathway in regulation of dnmt1Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam