Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

... 3.2 Characterization of flavonoids on PPAR and PPAR activity 103 3.3 Characterization of flavonoids and PPAR ligands on a natural PPAR V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... their clinical application especially in patients with heart failure (Arakawa et al 2004; Rangwala and Lazar 2004; Staels 2005) 1.3.2 Dual PPAR /PPAR ligands...

Ngày tải lên: 12/09/2015, 08:20

... aP

Ngày tải lên: 07/08/2014, 17:22

... PPARc agonist -induced apoptosis [26,27] In the present study, we investigated PPARc agonist -induced adipocyte apoptosis by using 3T3-L1 adipocytes and rat primary adipocytes Adipocyte apoptosis could ... troglitazone -induced adipocyte apoptosis is probably mediated by PPARc, GW9662 should have an inhibitory effect on adipocyte apoptosis As shown in Fig 2B...

Ngày tải lên: 16/02/2014, 09:20

... Summarizing picture: PPARα in lymphocytes Summarizing picture: PPARα in lymphocytes PPARα inhibits the actions of the pro-inflammatory transcription factors AP-1 and NFκB through protein-protein interactions ... analysis of inflammatory cells infiltrating the cystic fibrosis airway mucosa Clin Exp Immunol 2001, 124:69-76 Moss RB: Lymphocytes in cystic fibrosis lung disease: a ta...

Ngày tải lên: 12/08/2014, 16:20

... (PPAR) thuốc có đích tác dụng receptor PPAR ^ với mục tiêu chính: - Tổng quan receptor PPAR - Tổng quan số thuốc có đích tác dụng receptor PPAR PH ẦN RECEPTOR NHÂN TẾ BÀO 1.1 ĐỊNH NGHĨA VÀ PHÂN ... Adiponectin có tác dụng kháng viêm ức chế tạo thành TNF a yếu tố tiền viêm [64], 33 PH ẦN MỘT SỐ THUỐC CÓ ĐÍCH TÁC DỤNG LÀ PPAR Chất chủ vận PP...

Ngày tải lên: 27/07/2015, 21:55

... sp strain RHA1 The bacterial oxidase was found to be most active with eugenol, and hence has been named eugenol oxidase (EUGO) Results Properties and spectral characterization of EUGO EUGO can ... bound Covalent flavinylation was accompanied by an increase in oxidase activity and formation of hydrogen peroxide This confirms a mechanism of autocatalytic covalent flavinylation...

Ngày tải lên: 07/03/2014, 09:20

... AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] [58] [68] [69] [70] [71] FEBS Journal 272 (2005) 4754–47 73 ª 2005 FEBS 4765 Effect of ... (5¢-dACCGGAGAGGATATTTAGGCTGGGGCA TTGAAGGTTG -3 ; sense primer) vs Kin251 (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT -3 ; antisense primer) to generate pGL3b:Prm3abPPARc(a)* Mutation of the...

Ngày tải lên: 07/03/2014, 21:20

... PASMC proliferation Proliferation of PASMCs is a hallmark of pathogenesis of pulmonary hypertension [1,4] However, the mechanisms responsible for inhibition of PASMC proliferation by activation of ... Role of p21WAF1 in HO-1-mediated suppression of proliferation of PASMCs Recent studies have revealed that an antiproliferative effect of HO-1 on non-PASMC pulmonary...

Ngày tải lên: 15/03/2014, 10:20

... Regulation of < /b> PPARb turnover specific antibody because none of < /b> the < /b> available PPARb-specific antibodies are suitable for a quantifiable detection of < /b> PPARb at low expression < /b> levels In these experiments, ... protein level < /b> influence the < /b> degree of < /b> high Mr complex < /b> formation < /b> To investigate the < /b> nature of < /b> the < /b> high M...

Ngày tải lên: 30/03/2014, 03:20

... proliferation by green tea extract is considered to be mediated through the activation of PPARα Generally, black tea is derived as a result of full fermentation of the leaves of green tea The concentration ... concentration of EGCG in oolong tea falls between that of green tea and black tea [19] However, the transactivation expressed by oolong tea was less...

Ngày tải lên: 07/08/2014, 18:20

... TNF-α, forward 5'-GCCTCTTCTCATTCCTGCTT-3', reverse 5'-CACTTGGTGGTTTGCTACGA-3'; for IL-1β, forward 5'CCCAAGCAATACCCAAAGAA-3', reverse 5'-CATCAGAGGCAAGGAGGAAA-3'; for monocyte chemoattractant protein-1 ... (MCP-1), forward 5'-AGCCAGATGCAGTTAACGC-3', reverse 5'-CTGATCTCATTTGGTTCGGA-3'; for RANKL, forward 5'-GCTCCGAGCTGGTGAAGAAAT-3', reverse 5'CCCAAAGTACGTCGCATCTTG-3' Osteoclast differentiation a...

Ngày tải lên: 09/08/2014, 07:20

... studies, and drafted the manuscript DGH and DWA coordinated the animal study and sample collection JNH participated in intellectual discussion of the data AWN participated in the design of the ... (black) and skeletal muscle tissue from mice treated with a PPARd agonist (gray) containing the serine peak (d) Bar graph demonstrating the difference in the average inte...

Ngày tải lên: 11/08/2014, 12:20

... mediated by the antagonism of the NF-κB pathway [31] Interleukin-5 (IL-5) is the principal regulatory cytokine mediating eosinophil airway inflammation and extending the cell's survival Eosinophils ... are phagocytes involved in the ingestion and degradation of inhaled particles This activates a variety of inflammatory processes involving enhancement of their cytotoxic capabilities...

Ngày tải lên: 12/08/2014, 18:22

... 85:507-519 Mahieux R, Pecon-Slattery J, Gessain A: Molecular characterization and phylogenetic analyses of a new, highly divergent simian T-cell lymphotropic virus type (STLV-1marc1) in Macaca arctoides ... B, Vandamme AM, Heneine W, Switzer WM: Identification in gelada baboons (Theropithecus gelada) of a distinct simian T-cell lymphotropic virus type with a broad...

Ngày tải lên: 13/08/2014, 09:21

... Laboratory Animal Research (Singapore) National Institute of Standards and Technology Nuclear magnetic resonance Orthogonal partial least squares discriminant analysis Principal component analysis ... tomography PPARγ coactivator 1α P-glycoprotein Pioglitazone Partial least squares discriminant analysis Peroxisome proliferator- activated receptor Peroxisome proliferator- activate...

Ngày tải lên: 09/09/2015, 11:20