Sequential effects of a high fat, calorie dense diet or a high fiber diet on gene expression, body weight and associated metabolic responses in c57 BL6J mice
... Plasma insulin levels 42 Plasma leptin levels 43 Statistical analysis 44 iv CHAPTER SEQUENTIAL EFFECTS OF A HIGH- FAT, CALORIE- DENSE DIET ON FOOD INTAKE, BODY WEIGHT, PLASMA LIPIDS, LEPTIN AND GENE ... increasing in both prevalence and severity It is associated with increased risks of type diabetes and cardiovascular disease Increased food intake, particula...
Ngày tải lên: 12/09/2015, 08:20
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
... multifaceted implementation approach emphasizing collaborative learning and exchange of insights and support among a set of healthcare organizations, like a quality improvement collaborative ... albumin, and BMI per patient per year were performed Data about annually foot and eye examinations, consultations with dieticians and podiatrists, and counseling (advice a...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx
... contributions The comparison of test and control groups indicates that bone healing was accelerated by the effect of magnetic fields in all the conditions analyzed; The marked configuration of a bone ... surface On the external surface, its predominantly horizontal and flat direction maintained continuity and shape of the remaining cortical levels Trabecular...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo y học: "Effects of a multi-herbal extract on type 2 diabete" pptx
... Shin TY, Kim HM: Antianaphylactic activity of Poncirus trifoliata fruit extract J Ethnopharmacol 1996, 54:77-84 11 Yamahara J, Yamada T, Kitani T, Naitoh Y, Fujimura H: Antianoxic action and active ... Salicylate-based antiinflammatory drugs inhibit the early lesion of diabetic retinopathy Diabetes 20 07, 56:337-345 26 Kaneto H, Matsuoka TA, Nakatani Y, Kawamori D, Miyatsuka T, Mats...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot
... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... were all effective methyltransferase inhibitors Only AMI-1 and AMI-6 demonstrated selectivity for the PRMTs, although AMI-6 was minimally active against a cellular PRMT substrate [8] Com...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
... (2002) Ixolaris, a novel recombinant tissue factor pathway inhibitor (TFPI) from the salivary gland of the tick, Ixodes scapularis: identification of factor X and factor Xa as scaffolds for the inhibition ... placed in glass test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and nation...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried ... [33], the peptides containing a b-amino acid substitution in position have increased stability compared to the corresponding a- amino -acid- containing peptides...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... ADAM10 For further confirmation of these findings, we examined the myelination of peripheral nerves in ADAM10 transgenic mice and mice overexpressing dominant negative ADAM10 Because myelination ... Reconstitution experiments with transfection of ADAM10 in ADAM17) ⁄ ) embryonic mouse fibroblasts [55] suggested only a minor influence of ADAM10 on neuregulin-1 shedding, but...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt
... Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, the ... be the reason for the lack of linear correlation between protein bilinear indices and stability (tm) for these mutants, leading to a nonlinear depen...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
... a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native ... the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly rando...
Ngày tải lên: 31/03/2014, 09:20
báo cáo hóa học: "Quality of life in Brazilian obese adolescents: effects of a long-term multidisciplinary lifestyle therapy" pdf
... HKMA; WLP, AP, DAC, LT, JC: data collection, analysis and interpretation of data ST, MTM and ARD: Design and critically revising of the manuscript All authors read and approved the final manuscript ... depression, anxiety, binge eating, body image dissatisfaction, and quality of life in obese adolescents submitted to a multidisciplinary long-term lifestyle therapy Variable...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Effects of a robot-assisted training of grasp and pronation/supination in chronic stroke: a pilot stud" pot
... on robot-assisted rehabilitation of the hand, adopting a functional approach based on the combined training of grasping and forearm pronation/supination, two critical functions for manipulation ... who initially presented with minimal pain Robotassisted training may have helped pass a threshold of spontaneous arm use where ADL tasks involving arm and hand are performed at...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf
... 93(2):221-5 Pearson TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement ... benefit of an increase in VO2 max future research should evaluate the implication of a higher intensity workplace exercise training programme on the modification of...
Ngày tải lên: 20/06/2014, 00:20
The effects of a RMB devaluation on ASEAN economies
... that the inclusion of Hong Kong with the PRC implies that the renminbi devaluation is also accompanied by a devaluation of the Hong Kong dollar by the same amount Now the likelihood of Hong Kong ... significant market share in textiles and apparel and other manufactures TABLE Market Share of ASEAN and China in Selected Markets (Asian Crisis Simulation Result) SECTO...
Ngày tải lên: 23/07/2014, 15:27